Login to display prices
Login to display prices
PDLIM4-PDZ and LIM domain 4 Gene View larger

PDLIM4-PDZ and LIM domain 4 Gene

PTXBC016765

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PDLIM4-PDZ and LIM domain 4 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about PDLIM4-PDZ and LIM domain 4 Gene

Proteogenix catalog: PTXBC016765
Ncbi symbol: PDLIM4
Product name: PDLIM4-PDZ and LIM domain 4 Gene
Size: 2ug
Accessions: BC016765
Gene id: 8572
Gene description: PDZ and LIM domain 4
Synonyms: PDZ and LIM domain protein 4; LIM domain protein; LIM protein RIL; enigma homolog; reversion-induced LIM protein; PDZ and LIM domain 4
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgccccattccgtgaccctgcgcgggccttcgccctggggcttccgcctggtgggcggccgggacttcagcgcgcccctcaccatctcacgggtccatgctggcagcaaggctgcattggctgccctgtgcccaggagacctgatccaggccatcaatggtgagagcacagagctcatgacacacctggaggcacagaaccgcatcaagggctgccacgatcacctcacactgtctgtgagcaggcctgagggcaggagctggcccagtgcccctgatgacagcaaggctcaggcacacaggatccacatcgatcctgagatccaggacggcagcccaacaaccagcagggggccctcaggcaccgggactgggccagaagatggcagaccaagcctgggatctccatatggacaaccccctcgctttccagtccctcacaatggcagcagcgaggccaccctgccagcccagatgagcaccctgcatgtgtctccaccccccagcgctgacccagccagaggcctcccgcggagccgggactgcagagtcgacctgggctccgaggtgtacaggatgctgcgggagccagccgagcccgtggccgcggagcccaagcagtcaggctccttccgctacttgcagggcatgctagaggccggcgagggcggggattggcccgggcctggcggcccccggaacctcaagcccacggccagcaagctgggcgctccgctgagcggcctgcaggggctgcccgagtgcacgcgctgcggccacggcatcgtgggcaccatcgtcaaggcacgggacaagctctaccatcccgagtgcttcatgtgcagtgactgcggcctgaacctcaagcagcgtggttacttctttctggacgagcggctctactgtgagagccacgccaaggcgcgcgtgaagccgcccgagggctacgacgtggtggcggtgtaccccaatgccaaggtggaactcgtctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: