Login to display prices
Login to display prices
PDLIM1-PDZ and LIM domain 1 Gene View larger

PDLIM1-PDZ and LIM domain 1 Gene

PTXBC000915

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PDLIM1-PDZ and LIM domain 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about PDLIM1-PDZ and LIM domain 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC000915
Product type: DNA & cDNA
Ncbi symbol: PDLIM1
Origin species: Human
Product name: PDLIM1-PDZ and LIM domain 1 Gene
Size: 2ug
Accessions: BC000915
Gene id: 9124
Gene description: PDZ and LIM domain 1
Synonyms: CLIM1; CLP-36; CLP36; HEL-S-112; hCLIM1; PDZ and LIM domain protein 1; LIM domain protein CLP-36; carboxyl terminal LIM domain protein 1; elfin; epididymis secretory protein Li 112; PDZ and LIM domain 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaccacccagcagatagacctccagggcccggggccgtggggcttccgcctcgtgggcggcaaggacttcgagcagcctctcgccatttcccgggtcactcctggaagcaaggcggctctagctaatttatgtattggagatgtaatcacagccattgatggggaaaatactagcaatatgacacacttggaagctcagaacagaatcaaaggctgcacagacaacttgactctcactgtagccagatctgaacataaagtctggtctcctctggtgacggaggaagggaagcgtcatccatacaagatgaatttagcctctgaaccccaggaggtcctgcacataggaagcgcccacaaccgaagtgccatgccctttaccgcctcgcctgcctccagcactactgccagggtcatcacaaaccagtacaacaacccagctggcctctactcttctgaaaatatctccaacttcaacaatgccctggagtcaaagactgctgccagcggggtggaggcgaacagcagacccttagaccatgctcagcctccaagcagccttgtcatcgacaaagaatctgaagtttacaagatgcttcaggagaaacaggagttgaatgagcccccgaaacagtccacgtctttcttggttttgcaggaaatcctggagtctgaagaaaaaggggatcccaacaagccctcaggattcagaagtgttaaagctcctgtcactaaagtggctgcgtcgattggaaatgctcagaagttgcctatgtgtgacaaatgtggcactgggattgttggtgtgtttgtgaagctgcgggaccgtcaccgccaccctgagtgttatgtgtgcactgactgtggcaccaacctgaaacagaagggccatttctttgtggaggatcaaatctactgtgagaagcatgcccgggagcgagtcacaccacctgagggttatgaagtggtcactgtgttccccaagtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - PDZ and LIM domain 4
- carbonic anhydrase XIV
- transducer of ERBB2, 1
- angiopoietin-like 7