DLX5-distal-less homeobox 5 Gene View larger

DLX5-distal-less homeobox 5 Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of DLX5-distal-less homeobox 5 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about DLX5-distal-less homeobox 5 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC006226
Product type: DNA & cDNA
Ncbi symbol: DLX5
Origin species: Human
Product name: DLX5-distal-less homeobox 5 Gene
Size: 2ug
Accessions: BC006226
Gene id: 1749
Gene description: distal-less homeobox 5
Synonyms: SHFM1D; homeobox protein DLX-5; distal-less homeo box 5; split hand/foot malformation type 1 with sensorineural hearing loss; distal-less homeobox 5
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgacaggagtgtttgacagaagggtccccagcatccgatccggcgacttccaagctccgttccagacgtccgcagctatgcaccatccgtctcaggaatcgccaactttgcccgagtcttcagctaccgattctgactactacagccctacggggggagccccgcacggctactgctctcctacctcggcttcctatggcaaagctctcaacccctaccagtatcagtatcacggcgtgaacggctccgccgggagctacccagccaaagcttatgccgactatagctacgctagctcctaccaccagtacggcggcgcctacaaccgcgtcccaagcgccaccaaccagccagagaaagaagtgaccgagcccgaggtgagaatggtgaatggcaaaccaaagaaagttcgtaaacccaggactatttattccagctttcagctggccgcattacagagaaggtttcagaagactcagtacctcgccttgccggaacgcgccgagctggccgcctcgctgggattgacacaaacacaggtgaaaatctggtttcagaacaaaagatccaagatcaagaagatcatgaaaaacggggagatgcccccggagcacagtcccagctccagcgacccaatggcgtgtaactcgccgcagtctccagcggtgtgggagccccagggctcgtcccgctcgctcagccaccaccctcatgcccaccctccgacctccaaccagtccccagcgtccagctacctggagaactctgcatcctggtacacaagtgcagccagctcaatcaattcccacctgccgccgccgggctccttacagcacccgctggcgctggcctccgggacactctattag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - PHD finger protein 11
- hepatic leukemia factor
- mesenchyme homeobox 2
- WBP2 N-terminal like

Buy DLX5-distal-less homeobox 5 Gene now

Add to cart