Login to display prices
Login to display prices
DLX5-distal-less homeobox 5 Gene View larger

DLX5-distal-less homeobox 5 Gene

PTXBC006226

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of DLX5-distal-less homeobox 5 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about DLX5-distal-less homeobox 5 Gene

Proteogenix catalog: PTXBC006226
Ncbi symbol: DLX5
Product name: DLX5-distal-less homeobox 5 Gene
Size: 2ug
Accessions: BC006226
Gene id: 1749
Gene description: distal-less homeobox 5
Synonyms: SHFM1D; homeobox protein DLX-5; distal-less homeo box 5; split hand/foot malformation type 1 with sensorineural hearing loss; distal-less homeobox 5
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgacaggagtgtttgacagaagggtccccagcatccgatccggcgacttccaagctccgttccagacgtccgcagctatgcaccatccgtctcaggaatcgccaactttgcccgagtcttcagctaccgattctgactactacagccctacggggggagccccgcacggctactgctctcctacctcggcttcctatggcaaagctctcaacccctaccagtatcagtatcacggcgtgaacggctccgccgggagctacccagccaaagcttatgccgactatagctacgctagctcctaccaccagtacggcggcgcctacaaccgcgtcccaagcgccaccaaccagccagagaaagaagtgaccgagcccgaggtgagaatggtgaatggcaaaccaaagaaagttcgtaaacccaggactatttattccagctttcagctggccgcattacagagaaggtttcagaagactcagtacctcgccttgccggaacgcgccgagctggccgcctcgctgggattgacacaaacacaggtgaaaatctggtttcagaacaaaagatccaagatcaagaagatcatgaaaaacggggagatgcccccggagcacagtcccagctccagcgacccaatggcgtgtaactcgccgcagtctccagcggtgtgggagccccagggctcgtcccgctcgctcagccaccaccctcatgcccaccctccgacctccaaccagtccccagcgtccagctacctggagaactctgcatcctggtacacaagtgcagccagctcaatcaattcccacctgccgccgccgggctccttacagcacccgctggcgctggcctccgggacactctattag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: