ZDHHC19-zinc finger, DHHC-type containing 19 Gene View larger

ZDHHC19-zinc finger, DHHC-type containing 19 Gene

PTXBC022078

New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ZDHHC19-zinc finger, DHHC-type containing 19 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about ZDHHC19-zinc finger, DHHC-type containing 19 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC022078
Product type: DNA & cDNA
Ncbi symbol: ZDHHC19
Origin species: Human
Product name: ZDHHC19-zinc finger, DHHC-type containing 19 Gene
Size: 2ug
Accessions: BC022078
Gene id: 131540
Gene description: zinc finger, DHHC-type containing 19
Synonyms: DHHC19; DHHC-19; zinc finger DHHC domain-containing protein 19; zinc finger, DHHC domain containing 19; zinc finger DHHC-type containing 19
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgacactcttaacggatgccacgccgctggtgaaggagccccatcccctgcctctggtcccacgtccctggttcctccctagcctctttgctgccttcaatgtggtgctgctggtctttttcagtggcctcttcttcgcattcccttgcaggtggctggctcagaacggggagtgggcctttcctgttatcacaggctccctctttgtccttaccttcttcagtcttgtttcactcaacttctcagaccctggcatcttacatcaaggctccgctgagcagggccccttgacggtgcacgtggtgtgggtgaaccacggggccttccgcctgcaatggtgtccaaagtgctgcttccaccgcccgccccggacttaccactgcccctggtgcaacatctgtgtggaggactttgaccaccactgcaagtgggtcaataactgcatcggtcaccgcaacttccgcttcttcatgctgcttgtcctgtccctgtgcctctactcgggcgccatgctggtcacctgtctcatcttcctggtgcgcacaacccacctgcccttctccaccgacaaggccatcgccatcgtggtggccgtgtccgccgcgggcctcctggtgccgctgtccctcctgctgctgatccaggcactgtccgtgagctcggccgaccgcacctacaagggcaagtgcagacaccttcagggatacaaccccttcgaccagggctgtgccagcaactggtatttaacaatttgtgcaccactgggacccaaggctgctgcatcctggatgaggctggcctcagcttcctgcagagctaagccctgggccgtgtgcttcccaagctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - sulfotransferase family 4A, member 1
- sulfotransferase family 4A, member 1
- family with sequence similarity 122A
- family with sequence similarity 124A

Buy ZDHHC19-zinc finger, DHHC-type containing 19 Gene now

Add to cart