PTXBC010998
New product
This product is no longer in stock
Availability date:
| Brand | ProteoGenix | 
| Product type | DNA & cDNA | 
| Origin species | Human | 
| Brand: | ProteoGenix | 
| Proteogenix catalog: | PTXBC010998 | 
| Product type: | DNA & cDNA | 
| Ncbi symbol: | FHL1 | 
| Origin species: | Human | 
| Product name: | FHL1-four and a half LIM domains 1 Gene | 
| Size: | 2ug | 
| Accessions: | BC010998 | 
| Gene id: | 2273 | 
| Gene description: | four and a half LIM domains 1 | 
| Synonyms: | FHL-1; FHL1A; FHL1B; FLH1A; KYOT; RBMX1A; RBMX1B; SLIM; SLIM-1; SLIM1; SLIMMER; XMPMA; four and a half LIM domains protein 1; LIM protein SLIMMER; four-and-a-half Lin11, Isl-1 and Mec-3 domains 1; skeletal muscle LIM-protein 1; four and a half LIM domains 1 | 
| Sequence primers: | Forward primer M13R (5'â3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â3'): TAATACGACTCACTATAGG | 
| Orf sequence: | atggcggagaagtttgactgccactactgcagggatcccttgcaggggaagaagtatgtgcaaaaggatggccaccactgctgcctgaaatgctttgacaagttctgtgccaacacctgtgtggaatgccgcaagcccatcggtgcggactccaaggaggtgcactataagaaccgcttctggcatgacacctgcttccgctgtgccaagtgccttcaccccttggccaatgagacctttgtggccaaggacaacaagatcctgtgcaacaagtgcaccactcgggaggactcccccaagtgcaaggggtgcttcaaggccattgtggcaggagatcaaaacgtggagtacaaggggaccgtctggcacaaagactgcttcacctgtagtaactgcaagcaagtcatcgggactggaagcttcttccctaaaggggaggacttctactgcgtgacttgccatgagaccaagtttgccaagcattgcgtgaagtgcaacaaggccatcacatctggaggaatcacttaccaggatcagccctggcatgccgattgctttgtgtgtgttacctgctctaagaagctggctgggcagcgtttcaccgctgtggaggaccagtattactgcgtggattgctacaagaactttgtggccaagaagtgtgctggatgcaagaaccccatcactgggtttggtaaaggctccagtgtggtggcctatgaaggacaatcctggcacgactactgcttccactgcaaaaaatgctccgtgaatctggccaacaagcgctttgttttccaccaggagcaagtgtattgtcccgactgtgccaaaaagctgtaa | 
| Vector: | pDONR223 | 
| Delivery lead time in business days in europe: | 10-12 days | 
| Storage: | -20â | 
| Delivery condition: | Blue Ice | 
| Related products: | - RAS, dexamethasone-induced 1 - four and a half LIM domains 5 - E2F-associated phosphoprotein - heme oxygenase (decycling) 1  |