FHL1-four and a half LIM domains 1 Gene View larger

FHL1-four and a half LIM domains 1 Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of FHL1-four and a half LIM domains 1 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about FHL1-four and a half LIM domains 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC010998
Product type: DNA & cDNA
Ncbi symbol: FHL1
Origin species: Human
Product name: FHL1-four and a half LIM domains 1 Gene
Size: 2ug
Accessions: BC010998
Gene id: 2273
Gene description: four and a half LIM domains 1
Synonyms: FHL-1; FHL1A; FHL1B; FLH1A; KYOT; RBMX1A; RBMX1B; SLIM; SLIM-1; SLIM1; SLIMMER; XMPMA; four and a half LIM domains protein 1; LIM protein SLIMMER; four-and-a-half Lin11, Isl-1 and Mec-3 domains 1; skeletal muscle LIM-protein 1; four and a half LIM domains 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcggagaagtttgactgccactactgcagggatcccttgcaggggaagaagtatgtgcaaaaggatggccaccactgctgcctgaaatgctttgacaagttctgtgccaacacctgtgtggaatgccgcaagcccatcggtgcggactccaaggaggtgcactataagaaccgcttctggcatgacacctgcttccgctgtgccaagtgccttcaccccttggccaatgagacctttgtggccaaggacaacaagatcctgtgcaacaagtgcaccactcgggaggactcccccaagtgcaaggggtgcttcaaggccattgtggcaggagatcaaaacgtggagtacaaggggaccgtctggcacaaagactgcttcacctgtagtaactgcaagcaagtcatcgggactggaagcttcttccctaaaggggaggacttctactgcgtgacttgccatgagaccaagtttgccaagcattgcgtgaagtgcaacaaggccatcacatctggaggaatcacttaccaggatcagccctggcatgccgattgctttgtgtgtgttacctgctctaagaagctggctgggcagcgtttcaccgctgtggaggaccagtattactgcgtggattgctacaagaactttgtggccaagaagtgtgctggatgcaagaaccccatcactgggtttggtaaaggctccagtgtggtggcctatgaaggacaatcctggcacgactactgcttccactgcaaaaaatgctccgtgaatctggccaacaagcgctttgttttccaccaggagcaagtgtattgtcccgactgtgccaaaaagctgtaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - RAS, dexamethasone-induced 1
- four and a half LIM domains 5
- E2F-associated phosphoprotein
- heme oxygenase (decycling) 1

Buy FHL1-four and a half LIM domains 1 Gene now

Add to cart