Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of PLA2G15-phospholipase A2, group XV Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about PLA2G15-phospholipase A2, group XV Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC011640 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | PLA2G15 |
| Origin species: | Human |
| Product name: | PLA2G15-phospholipase A2, group XV Gene |
| Size: | 2ug |
| Accessions: | BC011640 |
| Gene id: | 23659 |
| Gene description: | phospholipase A2, group XV |
| Synonyms: | ACS; GXVPLA2; LLPL; LPLA2; LYPLA3; group XV phospholipase A2; 1-O-acylceramide synthase; LCAT-like lysophospholipase; lysophospholipase 3 (lysosomal phospholipase A2); lysosomal phospholipase A2; phospholipase A2 group XV |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggtggagagccttgtgggctggggctacacacggggtgaggatgtccgaggggctccctatgactggcgccgagccccaaatgaaaacgggccctacttcctggccctccgcgagatgatcgaggagatgtaccagctgtatgggggccctgtggtgctggttgcccacagtatgggcaacatgtacacgctctactttctgcagcggcagccgcaggcctggaaggacaagtatatccgggccttcgtgtcactgggtgcgccctgggggggcgtggccaagaccctgcgcgtcctggcttcaggagacaacaaccggatcccagtcatcgggcccctgaagatccgggagcagcagcggtcagctgtctccaccagctggctgctgccctacaactacacatggtcacctgagaaggtgttcgtgcagacacccacaatcaactacacactgcgggactaccgcaagttcttccaggacatcggctttgaagatggctggctcatgcggcaggacacagaagggctggtggaagccacgatgccacctggcgtgcagctgcactgcctctatggtactggcgtccccacaccagactccttctactatgagagcttccctgaccgtgaccctaaaatctgctttggtgacggcgatggtactgtgaacttgaagagtgccctgcagtgccaggcctggcagagccgccaggagcaccaagtgttgctgcaggagctgccaggcagcgagcacatcgagatgctggccaacgccaccaccctggcctatctgaaacgtgtgctccttgggccctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - four and a half LIM domains 1 - RAS, dexamethasone-induced 1 - four and a half LIM domains 5 - E2F-associated phosphoprotein |