GLIPR1L2-GLI pathogenesis-related 1 like 2 Gene View larger

GLIPR1L2-GLI pathogenesis-related 1 like 2 Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of GLIPR1L2-GLI pathogenesis-related 1 like 2 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about GLIPR1L2-GLI pathogenesis-related 1 like 2 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC029557
Product type: DNA & cDNA
Ncbi symbol: GLIPR1L2
Origin species: Human
Product name: GLIPR1L2-GLI pathogenesis-related 1 like 2 Gene
Size: 2ug
Accessions: BC029557
Gene id: 144321
Gene description: GLI pathogenesis-related 1 like 2
Synonyms: GLIPR1-like protein 2; GLI pathogenesis related 1 like 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggaggccgcaaggcccttcgcccgggagtggagggcccagtccctacccctggcagtagggggcgttttgaagctgcggctctgtgagctgtggctactgctactgggttctagtttgaacgccagatttttgccagacgaggaggacgtagactttatcaacgagtacgtgaacctccacaatgagctgcggggcgacgtcattccccgagggtctaacttgcgcttcatgacttgggatgtagctttatcacggactgctagagcatggggaaaaaaatgtttgtttacgcataatatttatttacaagatgtacaaatggtccatcctaaattttatggtattggtgaaaatatgtgggtcggccctgaaaatgaatttactgcaagtattgctatcagaagttggcatgcagagaagaaaatgtacaattttgaaaatggcagttgctctggagactgttctaattatattcagcttgtttgggaccactcttacaaagttggttgtgctgttactccatgttcaaaaattggacatattatacatgcagcaattttcatatgcaactatgcgccaggaggaacactgacgagaagaccttatgaaccaggaatattttgtactcgatgtggcagacgtgacaaatgcacagattttctatgcagtaagataaagaaaataaacatgaaaaaaatgcataatggattggacaagaaaaataagcgattgaacactagttttttatggtcatgttaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - 5'-nucleotidase, cytosolic III-like
- chromosome 1 open reading frame 89
- chromosome 5 open reading frame 44
- TGF beta-inducible nuclear protein 1

Buy GLIPR1L2-GLI pathogenesis-related 1 like 2 Gene now

Add to cart