Login to display prices
Login to display prices
GLIPR1L2-GLI pathogenesis-related 1 like 2 Gene View larger

GLIPR1L2-GLI pathogenesis-related 1 like 2 Gene

PTXBC029557

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of GLIPR1L2-GLI pathogenesis-related 1 like 2 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about GLIPR1L2-GLI pathogenesis-related 1 like 2 Gene

Proteogenix catalog: PTXBC029557
Ncbi symbol: GLIPR1L2
Product name: GLIPR1L2-GLI pathogenesis-related 1 like 2 Gene
Size: 2ug
Accessions: BC029557
Gene id: 144321
Gene description: GLI pathogenesis-related 1 like 2
Synonyms: GLIPR1-like protein 2; GLI pathogenesis related 1 like 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggaggccgcaaggcccttcgcccgggagtggagggcccagtccctacccctggcagtagggggcgttttgaagctgcggctctgtgagctgtggctactgctactgggttctagtttgaacgccagatttttgccagacgaggaggacgtagactttatcaacgagtacgtgaacctccacaatgagctgcggggcgacgtcattccccgagggtctaacttgcgcttcatgacttgggatgtagctttatcacggactgctagagcatggggaaaaaaatgtttgtttacgcataatatttatttacaagatgtacaaatggtccatcctaaattttatggtattggtgaaaatatgtgggtcggccctgaaaatgaatttactgcaagtattgctatcagaagttggcatgcagagaagaaaatgtacaattttgaaaatggcagttgctctggagactgttctaattatattcagcttgtttgggaccactcttacaaagttggttgtgctgttactccatgttcaaaaattggacatattatacatgcagcaattttcatatgcaactatgcgccaggaggaacactgacgagaagaccttatgaaccaggaatattttgtactcgatgtggcagacgtgacaaatgcacagattttctatgcagtaagataaagaaaataaacatgaaaaaaatgcataatggattggacaagaaaaataagcgattgaacactagttttttatggtcatgttaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: