Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of FRAG1-FGF receptor activating protein 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about FRAG1-FGF receptor activating protein 1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC009930 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | FRAG1 |
| Origin species: | Human |
| Product name: | FRAG1-FGF receptor activating protein 1 Gene |
| Size: | 2ug |
| Accessions: | BC009930 |
| Gene id: | 27315 |
| Gene description: | FGF receptor activating protein 1 |
| Synonyms: | FRAG1; CWH43-N; HPMRS3; MRT17; MRT21; post-GPI attachment to proteins factor 2; FGF receptor activating protein 1; cell wall biogenesis 43 N-terminal homolog; mental retardation, non-syndromic, autosomal recessive, 21; post-GPI attachment to proteins 2 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtaccaggtcccactaccactggatcgggatgggaccctggtacggctccgcttcaccatggtggccctggtcacggtctgctgtccacttgtcgccttcctcttctgcatcctctggtccctgctcttccacttcaaggagacaacggccacacactgtggggtgcccaattacctgccctcggtgagctcagccatcggcggggaggtgccccagcgctacgtgtggcgtttctgcatcggcctgcactcggcgcctcgcttcttggtggccttcgcctactggaaccactacctcagctgcacctccccgtgttcctgctatcgcccgctctgccgcctcaacttcggcctcaatgtcgtggagaacctcgcgttgctagtgctcacttatgtctcctcctccgaggacttcaccatccacgaaaatgctttcattgtgttcattgcctcatccctcgggcacatgctcctcacctgcattctctggcggttgaccaagaagcacacagatcgcaagtcctacagctggaaacagcggctcttcatcatcaacttcatctccttcttctcggcgctggctgtctactttcggcacaacatgtattgtgaggctggagtgtacaccatctttgccatcctggagtacactgttgtcttaaccaacatggcgttccacatgacggcctggtgggacttcgggaacaaggagctgctcataacctctcagcctgaggaaaagcgattctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - zinc finger, AN1-type domain 2B - ribosomal protein S4, Y-linked 1 - odd-skipped related 2 (Drosophila) - nuclear receptor binding factor 2 |