Login to display prices
Login to display prices
ZFAND2B-zinc finger, AN1-type domain 2B Gene View larger

ZFAND2B-zinc finger, AN1-type domain 2B Gene

PTXBC018415

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ZFAND2B-zinc finger, AN1-type domain 2B Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about ZFAND2B-zinc finger, AN1-type domain 2B Gene

Proteogenix catalog: PTXBC018415
Ncbi symbol: ZFAND2B
Product name: ZFAND2B-zinc finger, AN1-type domain 2B Gene
Size: 2ug
Accessions: BC018415
Gene id: 130617
Gene description: zinc finger, AN1-type domain 2B
Synonyms: AIRAPL; AN1-type zinc finger protein 2B; AIRAP-like protein; arsenite-inducible RNA-associated protein-like protein; zinc finger, AN1-type domain 2B; zinc finger AN1-type containing 2B
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggagtttccggacctcggcgctcactgttcggagccgagctgtcagcgcttggattttctgccgcttaagtgtgatgcctgctcaggcatcttctgcgcagaccatgtggcctacgcccagcatcactgtggatctgcttaccaaaaggatatccaggtacctgtgtgccctctctgtaatgtgcctgtgcctgtggccagaggggagccccctgaccgtgctgtgggagagcacattgacagagactgtcgctctgatccagcacagcaaaaacgtaagatcttcaccaataagtgtgaacgcgctggctgccggcagcgagaaatgatgaaactgacctgtgaacgctgtagccgaaacttctgcatcaagcaccggcatccactggaccatgattgctctggggaggggcacccaaccagccgggcaggacttgctgccatctccagagcacaagctgtggcttctacaagcactgtccccagcccaagtcaaaccatgccttcctgtacctctcccagcagagccacaacccgatctccgtcctggacagcccctccagtgattgctttgcagaatggcctgagtgaggatgaagctctgcagcgggccctggaaatgtccctggcagaaaccaaaccccaggttccaagttgtcaggaggaagaagacctagctttagcacaagcactgtcagccagtgaggcagaataccagcggcagcaggcccagagccgcagctcgaagccgtccaactgcagcctgtgctag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: