ZFAND2B-zinc finger, AN1-type domain 2B Gene View larger

ZFAND2B-zinc finger, AN1-type domain 2B Gene

PTXBC018415

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ZFAND2B-zinc finger, AN1-type domain 2B Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about ZFAND2B-zinc finger, AN1-type domain 2B Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC018415
Product type: DNA & cDNA
Ncbi symbol: ZFAND2B
Origin species: Human
Product name: ZFAND2B-zinc finger, AN1-type domain 2B Gene
Size: 2ug
Accessions: BC018415
Gene id: 130617
Gene description: zinc finger, AN1-type domain 2B
Synonyms: AIRAPL; AN1-type zinc finger protein 2B; AIRAP-like protein; arsenite-inducible RNA-associated protein-like protein; zinc finger, AN1-type domain 2B; zinc finger AN1-type containing 2B
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggagtttccggacctcggcgctcactgttcggagccgagctgtcagcgcttggattttctgccgcttaagtgtgatgcctgctcaggcatcttctgcgcagaccatgtggcctacgcccagcatcactgtggatctgcttaccaaaaggatatccaggtacctgtgtgccctctctgtaatgtgcctgtgcctgtggccagaggggagccccctgaccgtgctgtgggagagcacattgacagagactgtcgctctgatccagcacagcaaaaacgtaagatcttcaccaataagtgtgaacgcgctggctgccggcagcgagaaatgatgaaactgacctgtgaacgctgtagccgaaacttctgcatcaagcaccggcatccactggaccatgattgctctggggaggggcacccaaccagccgggcaggacttgctgccatctccagagcacaagctgtggcttctacaagcactgtccccagcccaagtcaaaccatgccttcctgtacctctcccagcagagccacaacccgatctccgtcctggacagcccctccagtgattgctttgcagaatggcctgagtgaggatgaagctctgcagcgggccctggaaatgtccctggcagaaaccaaaccccaggttccaagttgtcaggaggaagaagacctagctttagcacaagcactgtcagccagtgaggcagaataccagcggcagcaggcccagagccgcagctcgaagccgtccaactgcagcctgtgctag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - ribosomal protein S4, Y-linked 1
- odd-skipped related 2 (Drosophila)
- nuclear receptor binding factor 2
- myelin oligodendrocyte glycoprotein

Buy ZFAND2B-zinc finger, AN1-type domain 2B Gene now

Add to cart