Login to display prices
Login to display prices
RPS4Y1-ribosomal protein S4, Y-linked 1 Gene View larger

RPS4Y1-ribosomal protein S4, Y-linked 1 Gene

PTXBC010286

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of RPS4Y1-ribosomal protein S4, Y-linked 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about RPS4Y1-ribosomal protein S4, Y-linked 1 Gene

Proteogenix catalog: PTXBC010286
Ncbi symbol: RPS4Y1
Product name: RPS4Y1-ribosomal protein S4, Y-linked 1 Gene
Size: 2ug
Accessions: BC010286
Gene id: 6192
Gene description: ribosomal protein S4, Y-linked 1
Synonyms: RPS4Y; 40S ribosomal protein S4, Y isoform 1; 40S ribosomal protein S4, Y; ribosomal protein S4Y; ribosomal protein S4, Y-linked 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcccggggccccaagaagcacttaaagcgtgttgcagcgccgaagcattggatgcttgacaaactaacgggtgtatttgcacctcgtccatcgacaggtccccacaagctgagggaatgtcttcctctgatcgtcttcctcaggaatagactcaagtatgcgttgactggagatgaggtaaagaagatatgtatgcaacgtttcatcaaaattgatggcaaggttcgagtggatgtcacataccctgctggattcatggatgtcatcagcatcgagaagacaggtgaacatttccgcctggtctatgacaccaagggccgttttgctgttcaccgcatcacagtggaagaggcaaagtacaagttgtgcaaagtgaggaagattactgtgggagtgaagggaatccctcacctggtgactcatgatgctcgaaccatccgctacccagatcctgtcatcaaggtgaacgatactgtgcagattgatttagggactggcaagataatcaactttatcaaatttgatacaggcaatttgtgtatggtgattggtggagccaacctcggtcgtgttggtgtgatcaccaacagggaaagacatcctggttcttttgatgtggtgcatgtgaaggatgccaatggcaacagctttgccacgaggctttccaacatttttgtcattggcaatggcaataaaccttggatttccctgcccaggggaaagggcattcgacttactgttgctgaagagagagataagaggctggccaccaaacagagcagtggctaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: