RPS4Y1-ribosomal protein S4, Y-linked 1 Gene View larger

RPS4Y1-ribosomal protein S4, Y-linked 1 Gene

PTXBC010286

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of RPS4Y1-ribosomal protein S4, Y-linked 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about RPS4Y1-ribosomal protein S4, Y-linked 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC010286
Product type: DNA & cDNA
Ncbi symbol: RPS4Y1
Origin species: Human
Product name: RPS4Y1-ribosomal protein S4, Y-linked 1 Gene
Size: 2ug
Accessions: BC010286
Gene id: 6192
Gene description: ribosomal protein S4, Y-linked 1
Synonyms: RPS4Y; 40S ribosomal protein S4, Y isoform 1; 40S ribosomal protein S4, Y; ribosomal protein S4Y; ribosomal protein S4, Y-linked 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcccggggccccaagaagcacttaaagcgtgttgcagcgccgaagcattggatgcttgacaaactaacgggtgtatttgcacctcgtccatcgacaggtccccacaagctgagggaatgtcttcctctgatcgtcttcctcaggaatagactcaagtatgcgttgactggagatgaggtaaagaagatatgtatgcaacgtttcatcaaaattgatggcaaggttcgagtggatgtcacataccctgctggattcatggatgtcatcagcatcgagaagacaggtgaacatttccgcctggtctatgacaccaagggccgttttgctgttcaccgcatcacagtggaagaggcaaagtacaagttgtgcaaagtgaggaagattactgtgggagtgaagggaatccctcacctggtgactcatgatgctcgaaccatccgctacccagatcctgtcatcaaggtgaacgatactgtgcagattgatttagggactggcaagataatcaactttatcaaatttgatacaggcaatttgtgtatggtgattggtggagccaacctcggtcgtgttggtgtgatcaccaacagggaaagacatcctggttcttttgatgtggtgcatgtgaaggatgccaatggcaacagctttgccacgaggctttccaacatttttgtcattggcaatggcaataaaccttggatttccctgcccaggggaaagggcattcgacttactgttgctgaagagagagataagaggctggccaccaaacagagcagtggctaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - odd-skipped related 2 (Drosophila)
- nuclear receptor binding factor 2
- myelin oligodendrocyte glycoprotein
- coiled-coil domain containing 51

Buy RPS4Y1-ribosomal protein S4, Y-linked 1 Gene now

Add to cart