Login to display prices
Login to display prices
MRPL45-mitochondrial ribosomal protein L45 Gene View larger

MRPL45-mitochondrial ribosomal protein L45 Gene

PTXBC006235

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of MRPL45-mitochondrial ribosomal protein L45 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about MRPL45-mitochondrial ribosomal protein L45 Gene

Proteogenix catalog: PTXBC006235
Ncbi symbol: MRPL45
Product name: MRPL45-mitochondrial ribosomal protein L45 Gene
Size: 2ug
Accessions: BC006235
Gene id: 84311
Gene description: mitochondrial ribosomal protein L45
Synonyms: L45mt; MRP-L45; 39S ribosomal protein L45, mitochondrial; mitochondrial ribosomal protein L45
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcaacatgcccggaaagcaggattggttattcctccagaaaaatcggaccgttccatacatctggcctgtacagctggtatatttgatgcctatgttcctcctgagggtgatgcacgcatatcatctctttcaaaggagggactgatagagagaactgaacgaatgaagaagactatggcatcacaagtgtcaatccggaggataaaagactatgatgccaactttaaaataaaggacttccctgaaaaagctaaggatatctttattgaagctcacctttgtctaaataactcagaccatgaccgacttcataccttggtaactgaacactgttttccagacatgacttgggacatcaaatataagaccgtccgctggagctttgtggaatctttagagccctctcatgttgttcaagttcgctgttcaagtatgatgaaccagggcaacgtgtacggccagatcaccgtacgcatgcacacccggcagactctggccatctatgaccggtttggccggttgatgtatggacaggaagatgtacccaaggatgtcctggagtatgttgtattcgaaaagcagttgacaaacccctatggaagctggagaatgcataccaagatcgttcccccatgggcaccccctaagcagcccatccttaagacggtgatgatccctggccctcagctgaaaccagaagaagaatatgaagaggcacaaggagaggcccagaagcctcagctagcctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: