SECTM1-secreted and transmembrane 1 Gene View larger

SECTM1-secreted and transmembrane 1 Gene

PTXBC017716

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of SECTM1-secreted and transmembrane 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about SECTM1-secreted and transmembrane 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC017716
Product type: DNA & cDNA
Ncbi symbol: SECTM1
Origin species: Human
Product name: SECTM1-secreted and transmembrane 1 Gene
Size: 2ug
Accessions: BC017716
Gene id: 6398
Gene description: secreted and transmembrane 1
Synonyms: K12; secreted and transmembrane protein 1; type 1a transmembrane protein; secreted and transmembrane 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcagacctgccccctggcattccctggccacgtttcccaggcccttgggaccctcctgtttttggctgcctccttgagtgctcagaatgaaggctgggacagccccatctgcacagagggggtagtctctgtgtcttggggcgagaacaccgtcatgtcctgcaacatctccaacgccttctcccatgtcaacatcaagctgcgtgcccacgggcaggagagcgccatcttcaatgaggtggctccaggctacttctcccgggacggctggcagctccaggttcagggaggcgtggcacagctggtgatcaaaggcgcccgggactcccatgctgggctgtacatgtggcacctcgtgggacaccagagaaataacagacaagtcacgctggaggtttcaggtgcagaaccccagtccgcccctgacactgggttctggcctgtgccagcggtggtcactgctgtcttcatcctcttggtcgctctggtcatgttcgcctggtacaggtgccgctgttcccagcaacgccgggagaagaagttcttcctcctagaaccccagatgaagttcgcagccctcagagcgggagcccagcagggcctgagcagagcctccgctgaactgtggaccccagactccgagcccaccccaaggccgctggcactggtgttcaaaccctcaccacttggagccctggagctgctgtccccccaacccttgtttccatatgccgcagacccatag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - kallikrein-related peptidase 7
- ethylmalonic encephalopathy 1
- 2,3-bisphosphoglycerate mutase
- kallikrein-related peptidase 2

Buy SECTM1-secreted and transmembrane 1 Gene now

Add to cart