Cart 1 Product Products 113,40 € (empty)
-
1 x SLMO2-slow...113,40 €
No products
To be determined Shipping
113,40 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 1 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 113,40 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 113,40 €
Data sheet of ETHE1-ethylmalonic encephalopathy 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about ETHE1-ethylmalonic encephalopathy 1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC008250 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | ETHE1 |
| Origin species: | Human |
| Product name: | ETHE1-ethylmalonic encephalopathy 1 Gene |
| Size: | 2ug |
| Accessions: | BC008250 |
| Gene id: | 23474 |
| Gene description: | ethylmalonic encephalopathy 1 |
| Synonyms: | ETHE1, persulfide dioxygenase; sulfur dioxygenase ETHE1; protein ETHE1, mitochondrial; persulfide dioxygenase ETHE1, mitochondrial; HSCO; YF13H12; ethylmalonic encephalopathy 1; hepatoma subtracted clone one protein |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcggaggctgtactgagggtcgcccggcggcagctgagccagcgcggcgggtctggagcccccatcctcctgcggcagatgttcgagcctgtgagctgcaccttcacgtacctgctgggtgacagagagtcccgggaggccgttctgatcgacccagtcctggaaacagcgcctcgggatgcccagctgatcaaggagctggggctgcggctgctctatgctgtgaatacccactgccacgcggaccacattacaggctcggggctgctccgttccctcctccctggctgccagtctgtcatctcccgccttagtggggcccaggctgacttacacattgaggatggagactccatccgcttcgggcgcttcgcgttggagaccagggccagccctggccacaccccaggctgtgtcaccttcgtcctgaatgaccacagcatggccttcactggagatgccctgttgatccgtgggtgtgggcggacagacttccagcaaggctgtgccaagaccttgtaccactcggtccatgaaaagatcttcacacttccaggagactgtctgatctaccctgctcacgattaccatgggttcacagtgtccaccgtggaggaggagaggactctgaaccctcggctcaccctcagctgtgaggagtttgtcaaaatcatgggcaacctgaacttgcctaaacctcagcagatagactttgctgttccagccaacatgcgctgtggggtgcagacacccactgcctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - 2,3-bisphosphoglycerate mutase - kallikrein-related peptidase 2 - G protein-coupled receptor 87 - transmembrane protein 176B |