KLK2-kallikrein-related peptidase 2 Gene View larger

KLK2-kallikrein-related peptidase 2 Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of KLK2-kallikrein-related peptidase 2 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about KLK2-kallikrein-related peptidase 2 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC005196
Product type: DNA & cDNA
Ncbi symbol: KLK2
Origin species: Human
Product name: KLK2-kallikrein-related peptidase 2 Gene
Size: 2ug
Accessions: BC005196
Gene id: 3817
Gene description: kallikrein-related peptidase 2
Synonyms: KLK2A2; hGK-1; hK2; kallikrein-2; glandular kallikrein 2; glandular kallikrein-1; kallikrein 2, prostatic; tissue kallikrein-2; kallikrein related peptidase 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtgggacctggttctctccatcgccttgtctgtggggtgcactggtgccgtgcccctcatccagtctcggattgtgggaggctgggagtgtgagaagcattcccaaccctggcaggtggctgtgtacagtcatggatgggcacactgtgggggtgtcctggtgcacccccagtgggtgctcacagctgcccattgcctaaagaagaatagccaggtctggctgggtcggcacaacctgtttgagcctgaagacacaggccagagggtccctgtcagccacagcttcccacacccgctctacaatatgagccttctgaagcatcaaagccttagaccagatgaagactccagccatgacctcatgctgcttcgcctgtcagagcctgccaagatcacagatgttgtgaaggtcctgggcctgcccacccaggagccagcactggggaccacctgctacgcctcaggctggggcagcatcgaaccagaggagttcttgcgccccaggagtcttcagtgtgtgagcctccatctcctgtccaatgacatgtgtgctagagcttactctgagaaggtgacagagttcatgttgtgtgctgggctctggacaggtggtaaagacacttgtgggggtgattctgggggtccacttgtctgtaatggtgtgcttcaaggtatcacatcatggggccctgagccatgtgccctgcctgaaaagcctgctgtgtacaccaaggtggtgcattaccggaagtggatcaaggacaccatcgcagccaacccctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - G protein-coupled receptor 87
- transmembrane protein 176B
- ADP-ribosylhydrolase like 1
- pre-B-cell leukemia homeobox 3

Buy KLK2-kallikrein-related peptidase 2 Gene now

Add to cart