Login to display prices
Login to display prices
KLK7-kallikrein-related peptidase 7 Gene View larger

KLK7-kallikrein-related peptidase 7 Gene

PTXBC032005

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of KLK7-kallikrein-related peptidase 7 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about KLK7-kallikrein-related peptidase 7 Gene

Proteogenix catalog: PTXBC032005
Ncbi symbol: KLK7
Product name: KLK7-kallikrein-related peptidase 7 Gene
Size: 2ug
Accessions: BC032005
Gene id: 5650
Gene description: kallikrein-related peptidase 7
Synonyms: PRSS6; SCCE; hK7; kallikrein-7; kallikrein 7 (chymotryptic, stratum corneum); serine protease 6; signal protein; stratum corneum chymotryptic enzyme; kallikrein related peptidase 7
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcaagatcccttctcctgcccctgcagatcctactgctatccttagccttggaaactgcaggagaagaagcccagggtgacaagattattgatggcgccccatgtgcaagaggctcccacccatggcaggtggccctgctcagtggcaatcagctccactgcggaggcgtcctggtcaatgagcgctgggtgctcactgccgcccactgcaagatgaatgagtacaccgtgcacctgggcagtgatacgctgggcgacaggagagctcagaggatcaaggcctcgaagtcattccgccaccccggctactccacacagacccatgttaatgacctcatgctcgtgaagctcaatagccaggccaggctgtcatccatggtgaagaaagtcaggctgccctcccgctgcgaaccccctggaaccacctgtactgtctccggctggggcactaccacgagcccagatgtgacctttccctctgacctcatgtgcgtggatgtcaagctcatctccccccaggactgcacgaaggtttacaaggacttactggaaaattccatgctgtgcgctggcatccccgactccaagaaaaacgcctgcaatggtgactcagggggaccgttggtgtgcagaggtaccctgcaaggtctggtgtcctggggaactttcccttggggccaacccaatgacccaggagtctacactcaagtgtgcaagttcaccaagtggataaatgacaccatgaaaaagcatcgctaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: