PRR13-proline rich 13 Gene View larger

PRR13-proline rich 13 Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PRR13-proline rich 13 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about PRR13-proline rich 13 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC014257
Product type: DNA & cDNA
Ncbi symbol: PRR13
Origin species: Human
Product name: PRR13-proline rich 13 Gene
Size: 2ug
Accessions: BC014257
Gene id: 54458
Gene description: proline rich 13
Synonyms: TXR1; proline-rich protein 13; taxane-resistance protein; proline rich 13
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtggaatcccaatgccgggcagccagggccaaatccatatccccccaatattgggtgccctggaggttccaatcctgcccacccaccacctattaatccaccctttcccccaggcccctgtcctcctcccccaggagctccccatggcaatccagctttccccccaggtgggccccctcatcctgtgccacagccagggtatccaggatgccaaccgttgggtccctaccctcctccatacccaccgcctgcccctggaatccctcctgtgaatcccttggctcctggcatggttggaccagcagtgatagtagacaagaagatgcagaagaaaatgaagaaagctcataaaaagatgcacaagcaccaaaagcaccacaagtaccacaagcatggcaagcattcctcctcttcctcctcctcttccagcagtgattctgactga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - MAX interactor 1
- synaptogyrin 2
- neurexophilin 3
- peroxiredoxin 3

Buy PRR13-proline rich 13 Gene now

Add to cart