Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of CCDC115-coiled-coil domain containing 115 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about CCDC115-coiled-coil domain containing 115 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC006429 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | CCDC115 |
| Origin species: | Human |
| Product name: | CCDC115-coiled-coil domain containing 115 Gene |
| Size: | 2ug |
| Accessions: | BC006429 |
| Gene id: | 84317 |
| Gene description: | coiled-coil domain containing 115 |
| Synonyms: | CDG2O; ccp1; coiled-coil domain-containing protein 115; coiled-coil domain containing 115 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgggcgccaagtcggtagggcccctgcagtatgcttcccacatggagccccaggtctgcctccacgccagcgaggcccaggagggactccagaagttcaaggtggtgagagctggtgtccacgccccagaggaggtggggcctcgcgaagcaggtctgcggaggcgcaagggccccactaagaccccagaaccggagtcctctgaggcccctcaggaccccctgaactggtttggaatcctagttcctcacagtctacgtcaggctcaagcaagcttccgggatggcctgcagctggccgcagacatagccagcctccagaaccgcattgactggggtcgaagccagctccggggactccaagagaaactcaagcagctggagcctggggctgcctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - damage-regulated autophagy modulator - hypothetical protein MGC34034 - coiled-coil domain containing 108 - myosin regulatory light chain MRCL3 |