Login to display prices
Login to display prices
ABHD12B-abhydrolase domain containing 12B Gene View larger

ABHD12B-abhydrolase domain containing 12B Gene

PTXBC034603

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ABHD12B-abhydrolase domain containing 12B Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about ABHD12B-abhydrolase domain containing 12B Gene

Proteogenix catalog: PTXBC034603
Ncbi symbol: ABHD12B
Product name: ABHD12B-abhydrolase domain containing 12B Gene
Size: 2ug
Accessions: BC034603
Gene id: 145447
Gene description: abhydrolase domain containing 12B
Synonyms: protein ABHD12B; BEM46L3; C14orf29; c14_5314; abhydrolase domain-containing protein 12B; alpha/beta hydrolase domain-containing protein 12B; abhydrolase domain containing 12B
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtgggttgcaagtatcaattatcccttgttaaagatttaccggaacattccaggatttttacgtacacttatggatgccctgagaaaagacaaaataatctttcctaatgatgaaaatgttaaattcctttcttctcctcttctcatcttacatggagaggatgacaggacagtgcctttggagtatgggaaaaagctctatgaaattgcacgcaatgcatacaggaacaaagagagggtcaagatggttatctttcctcctggcttccaacacaacctgctttgtaaaagccccacactgttaataaccgtgagagatttcctgagcaagcagtggtcatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: