CYCS-cytochrome c, somatic Gene View larger

CYCS-cytochrome c, somatic Gene

PTXBC005299

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CYCS-cytochrome c, somatic Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about CYCS-cytochrome c, somatic Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC005299
Product type: DNA & cDNA
Ncbi symbol: CYCS
Origin species: Human
Product name: CYCS-cytochrome c, somatic Gene
Size: 2ug
Accessions: BC005299
Gene id: 54205
Gene description: cytochrome c, somatic
Synonyms: CYC; HCS; THC4; cytochrome c; cytochrome c, somatic
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgggtgatgttgagaaaggcaagaagatttttattatgaagtgttcccagtgccacaccgttgaaaagggaggcaagcacaagactgggccaaatctccatggtctctttgggcggaagacaggtcaggcccctggatactcttacacagccgccaataagaacaaaggcatcatctggggagaggatacactgatggagtatttggagaatcccaagaagtacatccctggaacaaaaatgatctttgtcggcattaagaagaaggaagaaagggcagacttaatagcttatctcaaaaaagctactaatgagtaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - ring finger protein 7
- centromere protein A
- chemokine-like factor
- crystallin, beta A2

Buy CYCS-cytochrome c, somatic Gene now

Add to cart