Login to display prices
Login to display prices
CRYBA2-crystallin, beta A2 Gene View larger

CRYBA2-crystallin, beta A2 Gene

PTXBC006285

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CRYBA2-crystallin, beta A2 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about CRYBA2-crystallin, beta A2 Gene

Proteogenix catalog: PTXBC006285
Ncbi symbol: CRYBA2
Product name: CRYBA2-crystallin, beta A2 Gene
Size: 2ug
Accessions: BC006285
Gene id: 1412
Gene description: crystallin, beta A2
Synonyms: CTRCT42; beta-crystallin A2; eye lens structural protein; crystallin beta A2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgagcagcgcccccgcgccgggcccggcgcccgccagcctcacgctctgggacgaggaggacttccagggccgtcgctgtcggctgctaagcgactgtgcgaacgtctgcgagcgcggaggcctgcccagggtgcgctcggtcaaggtggaaaacggcgtttgggtggcctttgagtaccccgacttccagggacagcagttcattctggagaagggagactatcctcgctggagcgcctggagtggcagcagcagccacaacagcaaccagctgctgtccttccggccagtgctctgcgcgaaccacaatgacagccgtgtgacactgtttgagggggacaacttccaaggctgcaagtttgacctcgttgatgactacccatccctgccctccatgggctgggccagcaaggatgtgggttccctcaaagtcagctccggagcgtgggtggcctaccagtacccaggctaccgaggctaccagtatgtgttggagcgggaccggcacagcggagagttctgtacttacggtgagctcggcacacaggcccacactgggcagctgcagtccatccggagagtccagcactag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice