Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of KLF6-Kruppel-like factor 6 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about KLF6-Kruppel-like factor 6 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC004301 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | KLF6 |
| Origin species: | Human |
| Product name: | KLF6-Kruppel-like factor 6 Gene |
| Size: | 2ug |
| Accessions: | BC004301 |
| Gene id: | 1316 |
| Gene description: | Kruppel-like factor 6 |
| Synonyms: | BCD1; CBA1; COPEB; CPBP; GBF; PAC1; ST12; ZF9; Krueppel-like factor 6; B-cell-derived protein 1; GC-rich binding factor; GC-rich sites-binding factor GBF; Kruppel-like zinc finger protein Zf9; core promoter element-binding protein; proto-oncogene BCD1; protooncogene B-cell derived 1; suppression of tumorigenicity 12 (prostate); suppressor of tumorigenicity 12 protein; transcription factor Zf9; Kruppel like factor 6 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggacgtgctccccatgtgcagcatcttccaggagctccagatcgtgcacgagaccggctacttctcggcgctgccgtctctggaggagtactggcaacagacctgcctagagctggaacgttacctccagagcgagccctgctatgtttcagcctcagaaatcaaatttgacagccaggaagatctgtggaccaaaatcattctggctcgggagaaaaaggaggaatccgaactgaagatatcttccagtcctccagaggacactctcatcagcccgagcttttgttacaacttagagaccaacagcctgaactcagatgtcagcagcgaatcctctgacagctccgaggaactttctcccacggccaagtttacctccgaccccattggcgaagttttggtcagctcgggaaaattgagctcctctgtcacctccacgcctccatcttctccggaactgagcagggaaccttctcaactgtggggttgcgtgcccggggagctgccctcgccagggaaggtgcgcagcgggacttcggggaagccaggtgacaagggaaatggcgatgcctcccccgacggcaggaggagggtgcaccggtgccactttaacggctgcaggaaagtttacaccaaaagctcccacttgaaagcacaccagcggacgcacacaggagaaaagccttacagatgctcatgggaagggtgtgagtggcgttttgcaagaagtgatgagttaaccaggcacttccgaaagcacaccggggccaagcctttttaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - lysyl oxidase-like 4 - centromere protein K - DNA helicase HEL308 - tropomyosin 1 (alpha) |