Login to display prices
Login to display prices
KLF6-Kruppel-like factor 6 Gene View larger

KLF6-Kruppel-like factor 6 Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of KLF6-Kruppel-like factor 6 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about KLF6-Kruppel-like factor 6 Gene

Proteogenix catalog: PTXBC004301
Ncbi symbol: KLF6
Product name: KLF6-Kruppel-like factor 6 Gene
Size: 2ug
Accessions: BC004301
Gene id: 1316
Gene description: Kruppel-like factor 6
Synonyms: BCD1; CBA1; COPEB; CPBP; GBF; PAC1; ST12; ZF9; Krueppel-like factor 6; B-cell-derived protein 1; GC-rich binding factor; GC-rich sites-binding factor GBF; Kruppel-like zinc finger protein Zf9; core promoter element-binding protein; proto-oncogene BCD1; protooncogene B-cell derived 1; suppression of tumorigenicity 12 (prostate); suppressor of tumorigenicity 12 protein; transcription factor Zf9; Kruppel like factor 6
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggacgtgctccccatgtgcagcatcttccaggagctccagatcgtgcacgagaccggctacttctcggcgctgccgtctctggaggagtactggcaacagacctgcctagagctggaacgttacctccagagcgagccctgctatgtttcagcctcagaaatcaaatttgacagccaggaagatctgtggaccaaaatcattctggctcgggagaaaaaggaggaatccgaactgaagatatcttccagtcctccagaggacactctcatcagcccgagcttttgttacaacttagagaccaacagcctgaactcagatgtcagcagcgaatcctctgacagctccgaggaactttctcccacggccaagtttacctccgaccccattggcgaagttttggtcagctcgggaaaattgagctcctctgtcacctccacgcctccatcttctccggaactgagcagggaaccttctcaactgtggggttgcgtgcccggggagctgccctcgccagggaaggtgcgcagcgggacttcggggaagccaggtgacaagggaaatggcgatgcctcccccgacggcaggaggagggtgcaccggtgccactttaacggctgcaggaaagtttacaccaaaagctcccacttgaaagcacaccagcggacgcacacaggagaaaagccttacagatgctcatgggaagggtgtgagtggcgttttgcaagaagtgatgagttaaccaggcacttccgaaagcacaccggggccaagcctttttaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: