Login to display prices
Login to display prices
TPM1-tropomyosin 1 (alpha) Gene View larger

TPM1-tropomyosin 1 (alpha) Gene

PTXBC007433

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of TPM1-tropomyosin 1 (alpha) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about TPM1-tropomyosin 1 (alpha) Gene

Proteogenix catalog: PTXBC007433
Ncbi symbol: TPM1
Product name: TPM1-tropomyosin 1 (alpha) Gene
Size: 2ug
Accessions: BC007433
Gene id: 7168
Gene description: tropomyosin 1 (alpha)
Synonyms: C15orf13; CMD1Y; CMH3; HEL-S-265; HTM-alpha; LVNC9; TMSA; tropomyosin alpha-1 chain; alpha-tropomyosin; cardiomyopathy, hypertrophic 3; epididymis secretory protein Li 265; sarcomeric tropomyosin kappa; tropomyosin 1 (alpha)
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggacgccatcaagaagaagatgcagatgctgaagctcgacaaggagaacgccttggatcgagctgagcaggcggaggccgacaagaaggcggcggaagacaggagcaagcagctggaagatgagctggtgtcactgcaaaagaaactcaagggcaccgaagatgaactggacaaatattctgaggctctcaaagatgcccaggagaagctggagctggcagagaaaaaggccaccgatgctgaagccgacgtagcttctctgaacagacgcatccagctggttgaggaagagttggatcgtgcccaggagcgtctggcaacagctttgcagaagctggaggaagctgagaaggcagcagatgagagtgagagaggcatgaaagtcattgagagtcgagcccaaaaagatgaagaaaaaatggaaattcaggagatccaactgaaagaggcaaagcacattgctgaagatgccgaccgcaaatatgaagaggtggcccgtaagctggtcatcattgagagcgacctggaacgtgcagaggagcgggctgagctctcagaaggccaagtccgacagctggaagaacaattaagaataatggatcagaccttgaaagcattaatggctgcagaggataagtactcgcagaaggaagacagatatgaggaagagatcaaggtcctttccgacaagctgaaggaggctgagactcgggctgagtttgcggagaggtcagtaactaaattggagaaaagcattgatgacttagaagacgagctgtacgctcagaaactgaagtacaaagccatcagcgaggagctggaccacgctctcaacgatatgacttccatgtaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: