ZNF2-zinc finger protein 2 Gene View larger

ZNF2-zinc finger protein 2 Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ZNF2-zinc finger protein 2 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about ZNF2-zinc finger protein 2 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC009976
Product type: DNA & cDNA
Ncbi symbol: ZNF2
Origin species: Human
Product name: ZNF2-zinc finger protein 2 Gene
Size: 2ug
Accessions: BC009976
Gene id: 7549
Gene description: zinc finger protein 2
Synonyms: A1-5; ZNF661; Zfp661; zinc finger protein 2; zinc finger protein 2.2; zinc finger protein 661
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgggaacagaaaagcaaagcccttcaggggagactcgtaagaaatccctctcccgggacaaaggcttgcggcgacggtcagccctgtccagggaaattctcactaaagagagacaccaggaatgcagtgactgtgggaagaccttttttgaccactcatccctcacccgccatcagaggactcacactggggagaagccctacgactgccgcgagtgtgggaaagccttcagccacaggagcagcctcagcagacatctgatgtcacacactggggagagcccctacgagtgcagtgtgtgctcaaaagccttctttgaccgttcgtccctaactgtccatcagcgaattcacactggagagaaaccctttcagtgcaacgagtgtggaaaagccttttttgaccgttcatcccttactcgacaccagagaattcacactggagaaagtccttatgaatgtcatcagtgtgggaaagcctttagccagaaaagtattcttactcgccatcagctaatccacactggcaggaagccttatgagtgtaacgagtgcgggaaagctttctatggtgtctcgtctctgaatagacatcagaaagctcatgctggggaccctcgctatcagtgtaacgagtgtggcaaagctttctttgaccgctcatcccttacacagcatcagaagatccacactggagacaagccatatgaatgcagcgaatgcgggaaagcctttagccagcggtgccggctcacgcggcatcagcgtgtccacacgggagagaagccctttgaatgcactgtgtgtgggaaagttttcagttcaaaatcttctgttattcaacatcaacggcgttacgccaaacagggaatagactga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - AE binding protein 2
- UBX domain protein 1
- centromere protein O
- uracil-DNA glycosylase

Buy ZNF2-zinc finger protein 2 Gene now

Add to cart