Login to display prices
Login to display prices
EXOSC7-exosome component 7 Gene View larger

EXOSC7-exosome component 7 Gene

PTXBC012831

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of EXOSC7-exosome component 7 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about EXOSC7-exosome component 7 Gene

Proteogenix catalog: PTXBC012831
Ncbi symbol: EXOSC7
Product name: EXOSC7-exosome component 7 Gene
Size: 2ug
Accessions: BC012831
Gene id: 23016
Gene description: exosome component 7
Synonyms: EAP1; RRP42; Rrp42p; hRrp42p; exosome complex component RRP42; exosome complex exonuclease RRP42; ribosomal RNA-processing protein 42; exosome component 7
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcgtccgtgacgctgagcgaggcggagaaggtgtacatcgtgcatggcgtccaggaagacctccgtgtggatggccgtggctgtgaggactaccgatgtgtcgaagtggaaactgatgtggtgtccaacactagtgggtccgccagggtcaagctgggtcacacagacatcttggtgggagtgaaagcagaaatggggacgccgaagctggagaaaccaaatgaaggctacttggagttctttgttgactgttcagccagtgctacccctgaatttgaaggtagaggaggtgatgaccttggcaccgagatcgctaacaccctctatcggatatttaacaataaaagcagtgtcgacttaaagaccctctgcattagtcctcgggagcactgctgggttctctatgtggatgtgctgcttctggaatgtggtggaaatttgtttgatgccatttccattgctgtaaaggctgctctcttcaatacaaggataccaagggttcgagttttggaggatgaagaggggtcgaaggacattgaattgtcagatgacccttatgactgcatacgactaagtgtggagaatgtcccctgcattgtcactctgtgcaagattggctatcggcatgtggtggatgctactcttcaggaggaggcctgctcgctggccagcttgctggtgtcggtgaccagcaagggagttgtgacgtgcatgaggaaagtggggaagggcagcctggacccagagagcatcttcgagatgatggagactggcaagcgtgtgggcaaggtactgcatgcctccttgcagagtgttctgcacaaggaagaaagcctggggcccaagagacagaaagttggattcctgggatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: