CKLF-chemokine-like factor Gene View larger

CKLF-chemokine-like factor Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CKLF-chemokine-like factor Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about CKLF-chemokine-like factor Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC004380
Product type: DNA & cDNA
Ncbi symbol: CKLF
Origin species: Human
Product name: CKLF-chemokine-like factor Gene
Size: 2ug
Accessions: BC004380
Gene id: 51192
Gene description: chemokine-like factor
Synonyms: C32; CKLF1; CKLF2; CKLF3; CKLF4; HSPC224; UCK-1; chemokine-like factor; chemokine-like factor 1; chemokine-like factor 2; chemokine-like factor 3; chemokine-like factor 4; transmembrane proteolipid
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggataacgtgcagccgaaaataaaacatcgccccttctgcttcagtgtgaaaggccacgtgaagatgctgcggctggcactaactgtgacatctatgaccttttttatcatcgcacaagcccctgaaccatatattgttatcactggatttgaagtcaccgttatcttatttttcatacttttatatgtactcagacttgatcgattaatgaagtggttattttggcctttgcttgatattatcaactcactggtaacaacagtattcatgctcatcgtatctgtgttggcactgataccagaaaccacaacattgacagttggtggaggggtgtttgcacttgtgacagcagtatgctgtcttgccgacggggcccttatttaccggaagcttctgttcaatcccagcggtccttaccagaaaaagcctgtgcatgaaaaaaaagaagttttgtaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - crystallin, beta A2
- nucleolar protein 12
- IQ motif containing H
- exosome component 4

Buy CKLF-chemokine-like factor Gene now

Add to cart