Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
HLA-DOB-major histocompatibility complex, class II, DO beta Gene
PTXBC020226
New product
Data sheet of HLA-DOB-major histocompatibility complex, class II, DO beta Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about HLA-DOB-major histocompatibility complex, class II, DO beta Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC020226 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | HLA-DOB |
| Origin species: | Human |
| Product name: | HLA-DOB-major histocompatibility complex, class II, DO beta Gene |
| Size: | 2ug |
| Accessions: | BC020226 |
| Gene id: | 3112 |
| Gene description: | major histocompatibility complex, class II, DO beta |
| Synonyms: | DOB; HLA class II histocompatibility antigen, DO beta chain; MHC class II antigen DOB; major histocompatibility complex, class II, DO beta |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgggttctgggtgggtcccctgggtggtggctctgctagtgaatctgacccgactggattcctccatgactcaaggcacagactctccaggtaagaacagagcaattgtttttttccagtgtgtatgcaagaattggcatgggggagtgatgcctttctttgtaagtccaggccacagaccagactggaagtggcttttggtttcaaagaacagtgttcttccctttggcagaaaggtacgccttgcctctttacatgggatggacttcatataccagagccacctattcaaggggtag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - BCL2/adenovirus E1B 19kDa interacting protein 3-like - myosin light chain 2, precursor lymphocyte-specific - potassium channel tetramerisation domain containing 4 - nucleophosmin (nucleolar phosphoprotein B23, numatrin) |