Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
MYLC2PL-myosin light chain 2, precursor lymphocyte-specific Gene
PTXBC002778
New product
Data sheet of MYLC2PL-myosin light chain 2, precursor lymphocyte-specific Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about MYLC2PL-myosin light chain 2, precursor lymphocyte-specific Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC002778 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | MYLC2PL |
| Origin species: | Human |
| Product name: | MYLC2PL-myosin light chain 2, precursor lymphocyte-specific Gene |
| Size: | 2ug |
| Accessions: | BC002778 |
| Gene id: | 93408 |
| Gene description: | myosin light chain 2, precursor lymphocyte-specific |
| Synonyms: | MYLC2PL; PLRLC; myosin regulatory light chain 10; myosin light chain 2, lymphocyte-specific; myosin light chain 2, precursor lymphocyte-specific; myosin, light chain 10, regulatory; precursor lymphocyte-specific regulatory light chain; myosin light chain 10 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgttgcttaggctggtctcaaactcctggcctcaagtgatcctccctcctcggcctcccaaagtgctgggattacaggcaccgagaagagctcggaaaagagcagaaggcaccgccagctccaacgtcttctccatgtttgatcagtcccagatccaggagtttaaagagagtctggctctgtcgcccaggctggagcgcaatggcatgatctcggctcactgcaacctctgcctcacgggttcaagcaattctcctgcctcagcctcccaagctttcaccatcatggaccagaaccgtgatggcttcatcgacaaagaggacttgagggacacctttgccgcgctgggccgcatcaatgtcaagaacgaggaactggaggccatggtgaaggaggcccccggacccatcaacttcacggtgttcctgaccatgtttggggagaagctgaagggcacggacccagaggagaccattctccacgccttcaaagtgttcgacactgaagggaaaggtttcgtcaaggccgatgtcatcaaagaaaaacttatgacccaggcagaccgcttcagtgaggaggaggtcaagcagatgtttgcagcgtttcccccagatgtgtgcggcaacctggactacagaaacctgtgctacgtcatcactcacggtgaagagaaggattag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - potassium channel tetramerisation domain containing 4 - nucleophosmin (nucleolar phosphoprotein B23, numatrin) - secreted protein, acidic, cysteine-rich (osteonectin) - transcriptional adaptor 2 (ADA2 homolog, yeast)-like |