Login to display prices
Login to display prices
MYLC2PL-myosin light chain 2, precursor lymphocyte-specific Gene View larger

MYLC2PL-myosin light chain 2, precursor lymphocyte-specific Gene

PTXBC002778

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of MYLC2PL-myosin light chain 2, precursor lymphocyte-specific Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about MYLC2PL-myosin light chain 2, precursor lymphocyte-specific Gene

Proteogenix catalog: PTXBC002778
Ncbi symbol: MYLC2PL
Product name: MYLC2PL-myosin light chain 2, precursor lymphocyte-specific Gene
Size: 2ug
Accessions: BC002778
Gene id: 93408
Gene description: myosin light chain 2, precursor lymphocyte-specific
Synonyms: MYLC2PL; PLRLC; myosin regulatory light chain 10; myosin light chain 2, lymphocyte-specific; myosin light chain 2, precursor lymphocyte-specific; myosin, light chain 10, regulatory; precursor lymphocyte-specific regulatory light chain; myosin light chain 10
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgttgcttaggctggtctcaaactcctggcctcaagtgatcctccctcctcggcctcccaaagtgctgggattacaggcaccgagaagagctcggaaaagagcagaaggcaccgccagctccaacgtcttctccatgtttgatcagtcccagatccaggagtttaaagagagtctggctctgtcgcccaggctggagcgcaatggcatgatctcggctcactgcaacctctgcctcacgggttcaagcaattctcctgcctcagcctcccaagctttcaccatcatggaccagaaccgtgatggcttcatcgacaaagaggacttgagggacacctttgccgcgctgggccgcatcaatgtcaagaacgaggaactggaggccatggtgaaggaggcccccggacccatcaacttcacggtgttcctgaccatgtttggggagaagctgaagggcacggacccagaggagaccattctccacgccttcaaagtgttcgacactgaagggaaaggtttcgtcaaggccgatgtcatcaaagaaaaacttatgacccaggcagaccgcttcagtgaggaggaggtcaagcagatgtttgcagcgtttcccccagatgtgtgcggcaacctggactacagaaacctgtgctacgtcatcactcacggtgaagagaaggattag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: