BNIP3L-BCL2/adenovirus E1B 19kDa interacting protein 3-like Gene View larger

BNIP3L-BCL2/adenovirus E1B 19kDa interacting protein 3-like Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of BNIP3L-BCL2/adenovirus E1B 19kDa interacting protein 3-like Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about BNIP3L-BCL2/adenovirus E1B 19kDa interacting protein 3-like Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC001559
Product type: DNA & cDNA
Ncbi symbol: BNIP3L
Origin species: Human
Product name: BNIP3L-BCL2/adenovirus E1B 19kDa interacting protein 3-like Gene
Size: 2ug
Accessions: BC001559
Gene id: 665
Gene description: BCL2/adenovirus E1B 19kDa interacting protein 3-like
Synonyms: BNIP3a; NIX; BCL2/adenovirus E1B 19 kDa protein-interacting protein 3-like; BCL2/adenovirus E1B 19 kDa protein-interacting protein 3A; BCL2/adenovirus E1B 19-kd protein-interacting protein 3a; BCL2/adenovirus E1B 19kDa interacting protein 3 like; NIP3-like protein X; NIP3L; adenovirus E1B19k-binding protein B5; BCL2 interacting protein 3 like
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtcgtcccacctagtcgagccgccgccgcccctgcacaacaacaacaacaactgcgaggaaaatgagcagtctctgcccccgccggccggcctcaacagttcctgggtggagctacccatgaacagcagcaatggcaatgataatggcaatgggaaaaatggggggctggaacacgtaccatcctcatcctccatccacaatggagacatggagaagattcttttggatgcacaacatgaatcaggacagagtagttccagaggcagttctcactgtgacagcccttcgccacaagaagatgggcagatcatgtttgatgtggaaatgcacaccagcagggaccatagctctcagtcagaagaagaagttgtagaaggagagaaggaagtcgaggctttgaagaaaagtgcggactgggtatcagactggtccagtagacccgaaaacattccacccaaggagttccacttcagacaccctaaacgttctgtgtctttaagcatgaggaaaagtggagccatgaagaaagggggtattttctccgcagaatttctgaaggtgttcattccatctctcttcctttctcatgttttggctttggggctaggcatctatattggaaagcgactgagcacaccctctgccagcacctactga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - myosin light chain 2, precursor lymphocyte-specific
- potassium channel tetramerisation domain containing 4
- nucleophosmin (nucleolar phosphoprotein B23, numatrin)
- secreted protein, acidic, cysteine-rich (osteonectin)

Buy BNIP3L-BCL2/adenovirus E1B 19kDa interacting protein 3-like Gene now

Add to cart