Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
BNIP3L-BCL2/adenovirus E1B 19kDa interacting protein 3-like Gene
PTXBC001559
New product
Data sheet of BNIP3L-BCL2/adenovirus E1B 19kDa interacting protein 3-like Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about BNIP3L-BCL2/adenovirus E1B 19kDa interacting protein 3-like Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC001559 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | BNIP3L |
| Origin species: | Human |
| Product name: | BNIP3L-BCL2/adenovirus E1B 19kDa interacting protein 3-like Gene |
| Size: | 2ug |
| Accessions: | BC001559 |
| Gene id: | 665 |
| Gene description: | BCL2/adenovirus E1B 19kDa interacting protein 3-like |
| Synonyms: | BNIP3a; NIX; BCL2/adenovirus E1B 19 kDa protein-interacting protein 3-like; BCL2/adenovirus E1B 19 kDa protein-interacting protein 3A; BCL2/adenovirus E1B 19-kd protein-interacting protein 3a; BCL2/adenovirus E1B 19kDa interacting protein 3 like; NIP3-like protein X; NIP3L; adenovirus E1B19k-binding protein B5; BCL2 interacting protein 3 like |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtcgtcccacctagtcgagccgccgccgcccctgcacaacaacaacaacaactgcgaggaaaatgagcagtctctgcccccgccggccggcctcaacagttcctgggtggagctacccatgaacagcagcaatggcaatgataatggcaatgggaaaaatggggggctggaacacgtaccatcctcatcctccatccacaatggagacatggagaagattcttttggatgcacaacatgaatcaggacagagtagttccagaggcagttctcactgtgacagcccttcgccacaagaagatgggcagatcatgtttgatgtggaaatgcacaccagcagggaccatagctctcagtcagaagaagaagttgtagaaggagagaaggaagtcgaggctttgaagaaaagtgcggactgggtatcagactggtccagtagacccgaaaacattccacccaaggagttccacttcagacaccctaaacgttctgtgtctttaagcatgaggaaaagtggagccatgaagaaagggggtattttctccgcagaatttctgaaggtgttcattccatctctcttcctttctcatgttttggctttggggctaggcatctatattggaaagcgactgagcacaccctctgccagcacctactga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - myosin light chain 2, precursor lymphocyte-specific - potassium channel tetramerisation domain containing 4 - nucleophosmin (nucleolar phosphoprotein B23, numatrin) - secreted protein, acidic, cysteine-rich (osteonectin) |