C21orf119-chromosome 21 open reading frame 119 Gene View larger

C21orf119-chromosome 21 open reading frame 119 Gene

PTXBC007928

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of C21orf119-chromosome 21 open reading frame 119 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about C21orf119-chromosome 21 open reading frame 119 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC007928
Product type: DNA & cDNA
Ncbi symbol: C21orf119
Origin species: Human
Product name: C21orf119-chromosome 21 open reading frame 119 Gene
Size: 2ug
Accessions: BC007928
Gene id: 84996
Gene description: chromosome 21 open reading frame 119
Synonyms: chromosome 21 open reading frame 119
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggggcgagcggacactccacgacaccccccgcccccggctgcagggtttggggtccaccggggcgcatttctgatcccagtggctcttcgggtgctcttggccggaagaactcccagacctttcactcctggcctggccgatccacgaagactcgggccccggcgcgtccaagcagcacaatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - chromosome 14 open reading frame 147
- enhancer of yellow 2 homolog (Drosophila)
- phosphoprotein enriched in astrocytes 15
- polymerase (RNA) I polypeptide D, 16kDa

Buy C21orf119-chromosome 21 open reading frame 119 Gene now

Add to cart