SLC25A23-solute carrier family 25 (mitochondrial carrier, phosphate carrier), member 23 Gene View larger

SLC25A23-solute carrier family 25 (mitochondrial carrier, phosphate carrier), member 23 Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of SLC25A23-solute carrier family 25 (mitochondrial carrier, phosphate carrier), member 23 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about SLC25A23-solute carrier family 25 (mitochondrial carrier, phosphate carrier), member 23 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC001656
Product type: DNA & cDNA
Ncbi symbol: SLC25A23
Origin species: Human
Product name: SLC25A23-solute carrier family 25 (mitochondrial carrier, phosphate carrier), member 23 Gene
Size: 2ug
Accessions: BC001656
Gene id: 79085
Gene description: solute carrier family 25 (mitochondrial carrier; phosphate carrier), member 23
Synonyms: APC2; MCSC2; SCaMC-3; calcium-binding mitochondrial carrier protein SCaMC-3; mitochondrial ATP-Mg/Pi carrier protein 2; mitochondrial Ca(2+)-dependent solute carrier protein 2; mitochondrial Ca2+-dependent solute carrier protein 2; short calcium-binding mitochondrial carrier 3; small calcium-binding mitochondrial carrier protein 3; solute carrier family 25 (mitochondrial carrier; phosphate carrier), member 23; solute carrier family 25 member 23
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcgggggagcccgggcgacgcggagcggcggcagcgctggggtcgcctgttcgaggagctggacagtaacaaggatggccgcgtggacgtgcacgagttgcgccaggggctggccaggctgggcgggggcaacccagaccccggcgcccaacagggtatctcctctgagggtgatgctgacccagatggcgggctcgacctggaggaattttcccgctatctgcaggagcgggaacagcgtctgctgctcatgtttcacagtcttgaccggaaccaggatggtcacattgatgtctctgagatccaacagagtttccgagctctgggcatttccatctcgctggagcaggctgagaaaattttgcacagcatggaccgagacggcacaatgaccattgactggcaagaatggcgcgaccacttcctgttgcattcgctggaaaatgtggaggacgtgctgtatttctggaagcattccacgctctcttctgctgggttctctgcctggataaaagattctacggctgaacagaatcgttcaaaaaccacggtcttggccaggcgcagtggctcacacctgaaatcccagcactttgggaggccgaagtgggcggatcacgaggtcctggacattggcgagtgcctgacagtgccggacgagttctcaaagcaagagaagctgacgggcatgtggtggaaacagctggtggccggcgcagtggcaggtgccgtgtcacggacaggcacggcccctctggaccgcctcaaggtcttcatgcaggtccatgcctcaaagaccaaccggctgaacatccttggggggcttcgaagcatggtccttgagggaggcatccgctccctgtggcgcggcaatggtattaatgtactcaagattgcccccgagtcagctatcaagttcatggcctatgaacagatcaagagggccatcctggggcagcaggagacactgcatgtgcaggagcgcttcgtggctggctccctggctggtgccacagcccaaaccatcatttaccctatggaggtgctgaagacgcggctgaccttgcgccggacgggccagtataaggggctgctggactgcgccaggcgtatcctggagagggaggggccccgtgccttctaccgcggctacctccccaacgtgctgggcatcatcccctatgcgggcatcgacctggccgtctacgagactctgaagaactggtggcttcagcagtacagccacgactcggcagacccaggcatcctcgtgctcctggcctgcggtaccatatccagcacctgcggccagatagccagttacccgctggccctggtccggacccgcatgcaggcacaaggctggagtacagtggctcgatttcagatcactgcaacctctgccttccaggttcaagcgattctcctgcctcagcctccagagtag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - fatty acid binding protein 3, muscle and heart (mammary-derived growth inhibitor)
- solute carrier family 25 (mitochondrial carrier; citrate transporter), member 1
- solute carrier family 7, (cationic amino acid transporter, y+ system) member 11
- solute carrier family 7 (cationic amino acid transporter, y+ system), member 14

Buy SLC25A23-solute carrier family 25 (mitochondrial carrier, phosphate carrier), member 23 Gene now

Add to cart