Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
SLC25A1-solute carrier family 25 (mitochondrial carrier, citrate transporter), member 1 Gene
PTXBC004980
New product
Data sheet of SLC25A1-solute carrier family 25 (mitochondrial carrier, citrate transporter), member 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about SLC25A1-solute carrier family 25 (mitochondrial carrier, citrate transporter), member 1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC004980 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | SLC25A1 |
| Origin species: | Human |
| Product name: | SLC25A1-solute carrier family 25 (mitochondrial carrier, citrate transporter), member 1 Gene |
| Size: | 2ug |
| Accessions: | BC004980 |
| Gene id: | 6576 |
| Gene description: | solute carrier family 25 (mitochondrial carrier; citrate transporter), member 1 |
| Synonyms: | CTP; D2L2AD; SEA; SLC20A3; tricarboxylate transport protein, mitochondrial; citrate transport protein; solute carrier family 20 (mitochondrial citrate transporter), member 3; solute carrier family 25 (mitochondrial carrier; citrate transporter), member 1; tricarboxylate carrier protein; solute carrier family 25 member 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgcccgcgccccgcgccccgcgcgctctggcggccgccgcgcccgcgtccgggaaggccaagctgacgcacccggggaaggcgatcctggcaggcggcctggcgggtggcatcgagatctgcatcaccttccccaccgagtacgtgaagacgcagctgcagctggacgagcgctcgcacccgccgcggtaccggggcatcggggactgcgtgcggcagacggttcgcagccatggcgtcctgggcctgtaccgcggccttagctccctgctctacggttccatccccaaggcggccgtcaggtttggaatgttcgagttcctcagcaaccacatgcgggatgcccagggacggctggacagcacgcgtgggctgctgtgcggcctgggcgctggcgtggccgaggccgtggtggtcgtgtgccccatggagaccatcaaggtgaagttcatccacgaccagacctccccaaaccccaagtacagaggattcttccacggggttagggagattgtgcgggaacaagggctgaaggggacgtaccagggcctcacagccactgtcctgaagcagggctcgaaccaggccatccgcttcttcgtcatgacctccctgcgcaactggtaccgaggggacaaccccaacaagcccatgaaccctctgatcactggggtcttcggagctattgcaggcgcagccagtgtctttggaaacactcctctggatgtgattaagacccggatgcagggcctggaggcgcacaaataccggaacacgtgggactgcggcttgcagatcctgaagaaggaggggctcaaggcattctacaagggcactgtcccccgcctgggccgggtctgcctggatgtggccatagtgtttgtcatctatgatgaagtggtgaagctgctcaacaaagtgtggaagacggactaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - solute carrier family 7, (cationic amino acid transporter, y+ system) member 11 - solute carrier family 7 (cationic amino acid transporter, y+ system), member 14 - methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 2, methenyltetrahydrofolate cyclohydrolase - steroid-5-alpha-reductase, alpha polypeptide 2 (3-oxo-5 alpha-steroid delta 4-dehydrogenase alpha 2) |