Login to display prices
Login to display prices
SLC25A1-solute carrier family 25 (mitochondrial carrier, citrate transporter), member 1 Gene View larger

SLC25A1-solute carrier family 25 (mitochondrial carrier, citrate transporter), member 1 Gene

PTXBC004980

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of SLC25A1-solute carrier family 25 (mitochondrial carrier, citrate transporter), member 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about SLC25A1-solute carrier family 25 (mitochondrial carrier, citrate transporter), member 1 Gene

Proteogenix catalog: PTXBC004980
Ncbi symbol: SLC25A1
Product name: SLC25A1-solute carrier family 25 (mitochondrial carrier, citrate transporter), member 1 Gene
Size: 2ug
Accessions: BC004980
Gene id: 6576
Gene description: solute carrier family 25 (mitochondrial carrier; citrate transporter), member 1
Synonyms: CTP; D2L2AD; SEA; SLC20A3; tricarboxylate transport protein, mitochondrial; citrate transport protein; solute carrier family 20 (mitochondrial citrate transporter), member 3; solute carrier family 25 (mitochondrial carrier; citrate transporter), member 1; tricarboxylate carrier protein; solute carrier family 25 member 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcccgcgccccgcgccccgcgcgctctggcggccgccgcgcccgcgtccgggaaggccaagctgacgcacccggggaaggcgatcctggcaggcggcctggcgggtggcatcgagatctgcatcaccttccccaccgagtacgtgaagacgcagctgcagctggacgagcgctcgcacccgccgcggtaccggggcatcggggactgcgtgcggcagacggttcgcagccatggcgtcctgggcctgtaccgcggccttagctccctgctctacggttccatccccaaggcggccgtcaggtttggaatgttcgagttcctcagcaaccacatgcgggatgcccagggacggctggacagcacgcgtgggctgctgtgcggcctgggcgctggcgtggccgaggccgtggtggtcgtgtgccccatggagaccatcaaggtgaagttcatccacgaccagacctccccaaaccccaagtacagaggattcttccacggggttagggagattgtgcgggaacaagggctgaaggggacgtaccagggcctcacagccactgtcctgaagcagggctcgaaccaggccatccgcttcttcgtcatgacctccctgcgcaactggtaccgaggggacaaccccaacaagcccatgaaccctctgatcactggggtcttcggagctattgcaggcgcagccagtgtctttggaaacactcctctggatgtgattaagacccggatgcagggcctggaggcgcacaaataccggaacacgtgggactgcggcttgcagatcctgaagaaggaggggctcaaggcattctacaagggcactgtcccccgcctgggccgggtctgcctggatgtggccatagtgtttgtcatctatgatgaagtggtgaagctgctcaacaaagtgtggaagacggactaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: