Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
FABP3-fatty acid binding protein 3, muscle and heart (mammary-derived growth inhibitor) Gene
PTXBC007021
New product
Data sheet of FABP3-fatty acid binding protein 3, muscle and heart (mammary-derived growth inhibitor) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about FABP3-fatty acid binding protein 3, muscle and heart (mammary-derived growth inhibitor) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC007021 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | FABP3 |
| Origin species: | Human |
| Product name: | FABP3-fatty acid binding protein 3, muscle and heart (mammary-derived growth inhibitor) Gene |
| Size: | 2ug |
| Accessions: | BC007021 |
| Gene id: | 2170 |
| Gene description: | fatty acid binding protein 3, muscle and heart (mammary-derived growth inhibitor) |
| Synonyms: | FABP11; H-FABP; M-FABP; MDGI; O-FABP; fatty acid-binding protein, heart; fatty acid binding protein 11; fatty acid binding protein 3, muscle and heart; heart-type fatty acid-binding protein; mammary-derived growth inhibitor; muscle fatty acid-binding protein; fatty acid binding protein 3 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggtggacgctttcctgggcacctggaagctagtggacagcaagaatttcgatgactacatgaagtcactcggtgtgggttttgctaccaggcaggtggccagcatgaccaagcctaccacaatcatcgaaaagaatggggacattctcaccctaaaaacacacagcaccttcaagaacacagagatcagctttaagttgggggtggagttcgatgagacaacagcagatgacaggaaggtcaagtccattgtgacactggatggagggaaacttgttcacctgcagaaatgggacgggcaagagaccacacttgtgcgggagctaattgatggaaaactcatcctgacactcacccacggcactgcagtttgcactcgcacttatgagaaagaggcatga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - solute carrier family 25 (mitochondrial carrier; citrate transporter), member 1 - solute carrier family 7, (cationic amino acid transporter, y+ system) member 11 - solute carrier family 7 (cationic amino acid transporter, y+ system), member 14 - methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 2, methenyltetrahydrofolate cyclohydrolase |