LDB1-LIM domain binding 1 Gene View larger

LDB1-LIM domain binding 1 Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of LDB1-LIM domain binding 1 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about LDB1-LIM domain binding 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC000482
Product type: DNA & cDNA
Ncbi symbol: LDB1
Origin species: Human
Product name: LDB1-LIM domain binding 1 Gene
Size: 2ug
Accessions: BC000482
Gene id: 8861
Gene description: LIM domain binding 1
Synonyms: CLIM-2; CLIM2; LDB-1; NLI; LIM domain-binding protein 1; LIM domain-binding factor CLIM2; LIM domain-binding factor-1; carboxy terminal LIM domain protein 2; carboxyl-terminal LIM domain-binding protein 2; nuclear LIM interactor; LIM domain binding 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgctggatagggatgtgggcccaactcccatgtatccgcctacatacctggagccagggattgggaggcacacaccatatggcaaccaaactgactacagaatatttgagcttaacaaacggcttcagaactggacagaggagtgtgacaatctctggtgggatgcattcacgactgagttctttgaggatgatgccatgttgaccatcactttctgcctggaggatggaccaaagagatataccattggccggaccctgatcccacgctacttccgcagcatctttgaggggggtgctacggagctgtactatgttcttaagcaccccaaggaggcattccacagcaactttgtgtccctcgactgtgaccagggcagcatggtgacccagcatggcaagcccatgttcacccaggtgtgtgtggagggccggttgtacctggagttcatgtttgacgacatgatgcggataaagacgtggcacttcagcatccggcagcaccgagagctcatcccccgcagcatccttgccatgcatgcccaagacccccagatgttggatcagctctccaaaaacatcactcggtgtgggctgtccaattccactctcaactacctccgactctgtgtgatactcgagcccatgcaagagctcatgtcacgccacaagacctacagcctcagcccccgcgactgcctcaagacctgccttttccagaagtggcagcgcatggtagcaccccctgcggagcccacacgtcagcagcccagcaaacggcggaaacggaagatgtcagggggcagcaccatgagctctggtggtggcaacaccaacaacagcaacagcaagaagaagagcccagctagcaccttcgccctctccagccaggtacctgatgtgatggtggtgggggagcccaccctgatgggcggggagttcggggacgaggacgagaggctcatcacccggctggagaacacccagtttgacgcagccaacggcattgacgacgaggacagctttaacaactcccctgcactgggcgccaacagcccctggaacagcaagcctccgtccagccaagaaagcaaatcggagaaccccacgtcacaggcctcccagtaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - PHD finger protein 7
- WD repeat domain 34
- WD repeat domain 18
- WD repeat domain 19

Buy LDB1-LIM domain binding 1 Gene now

Add to cart