WDR18-WD repeat domain 18 Gene View larger

WDR18-WD repeat domain 18 Gene

PTXBC001648

New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of WDR18-WD repeat domain 18 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about WDR18-WD repeat domain 18 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC001648
Product type: DNA & cDNA
Ncbi symbol: WDR18
Origin species: Human
Product name: WDR18-WD repeat domain 18 Gene
Size: 2ug
Accessions: BC001648
Gene id: 57418
Gene description: WD repeat domain 18
Synonyms: Ipi3; R32184_1; WD repeat-containing protein 18; Involved in Processing ITS2 3 homolog; WD repeat domain 18
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcggcgcccatggaggtggccgtgtgtacggactcggcggccccgatgtggagctgcatcgtgtgggaacttcactcgggcgccaacctgctcacctaccgcggcggccaggcgggaccccgcggcctggcgctgctcaatggcgagtatctgctggcggcgcagctgggcaagaattacatcagcgcctgggagctccagcggaaggaccagctccagcagaagatcatgtgccccgggcctgtcacctgtctgactgcatcacccaatggtctctacgtcctggcaggagttgcagaaagcatccacctgtgggaggtctccaccgggaaccttctggtcatcctgagtcgacactaccaggacgtctcctgccttcagttcacaggggacagcagccacttcatctcagggggcaaggactgcctggtgctggtttggagcctctgcagcgtgctgcaggccgacccctccaggattccggcgcccaggcacgtctggtctcaccacacgctccccatcacggacctgcactgcggctttgggggccccctggcccgggtggccacctcctcactggaccagacggtgaagctatgggaggtctcctcgggggagctgctgctctccgtcctctttgacgtgtccatcatggcagtgaccatggacctggctgagcaccatatgttctgcgggggcagtgagggctccatcttccaggtcgacctcttcacctggcccggacagagggagaggagcttccacccagagcaggacgccgggaaggtcttcaaagggcacaggaaccaggtgacttgcctgtcagtgtccactgacggcagcgtgctgctctcaggctcccacgacgagaccgtgcgcctctgggacgtgcagagcaagcagtgcatccggacggtggccctcaaaggcccagtcaccaatgccgccatcctgctggcgcccgtcagcatgctgagctcagacttcaggcccagcctgccgctgccccacttcaacaagcacctgctgggcgccgagcacggggacgagccgcgccacgggggcctcactctgcgcctgggcctccaccagcagggctcggagcccagctacctggaccgcacggagcagctgcaggccgtcctgtgcagcaccatggagaagagcgtgctcggcggccaggaccagctgcgcgtccgtgtgacggagctggaggacgaggtgcgcaacctgcgcaagatcaatcgggacctgttcgacttctccacgcgcttcatcacgcggccggccaagtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - WD repeat domain 19
- ferredoxin reductase
- WD repeat domain 78
- podocalyxin-like 2

Buy WDR18-WD repeat domain 18 Gene now

Add to cart