Login to display prices
Login to display prices
WDR19-WD repeat domain 19 Gene View larger

WDR19-WD repeat domain 19 Gene

PTXBC032578

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of WDR19-WD repeat domain 19 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about WDR19-WD repeat domain 19 Gene

Proteogenix catalog: PTXBC032578
Ncbi symbol: WDR19
Product name: WDR19-WD repeat domain 19 Gene
Size: 2ug
Accessions: BC032578
Gene id: 57728
Gene description: WD repeat domain 19
Synonyms: ATD5; CED4; DYF-2; IFT144; NPHP13; ORF26; Oseg6; PWDMP; SRTD5; WD repeat-containing protein 19; WD repeat membrane protein PWDMP; intraflagellar transport 144 homolog; WD repeat domain 19
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaagcgtattttctcactgctagaaaagacttggcttggcgcaccaatacagtttgcctggcaaaaaacatcaggaaactaccttgcagtaacaggagctgattatattgtgaaaatctttgatcgccatggtcaaaaaagaagtgaaattaacttacctggtaactgtgttgccatggattgggataaagatggagatgtcctagcagtgattgctgagaaatctagctgcatttatctttgggatgccaacacaaataagaccagccagttagacaatggcatgagggatcaaatgtctttccttctttggtcaaaagttggaagtttcctggctgttggaactgttaaaggaaatttgcttatttataatcatcagacatctcgaaagattcctgtccttggaaaacatactaagagaatcacttgtggatgttggaatgcagaaaatctgcttgctttaggtggtgaagataaaatgattacagttagtaatcaggaaggtgacacgataagacagacacaagtgagatcagagcctagcaacatgcagtttttcttgatgaagatggatgaccgaacctctgctgctgaaagcatgataagtgtggtgcttggcaagaaaactttgttttttttaaatctgaatgaaccagataacccagctgatcttgaatttcagcaggactttggcaacattgtctgctataattggtatggtgatggccgcatcatgattggtttttcatgtggacattttgtggtcatttctactcatactggagagcttggtcaagagatatttcaggctcgtaaccataaagataatctaaccagcattgcagtatcacagactcttaacaaagttgctacatgtggagataactgtattaaaatccaagacttggttgacttaaaagacatgtatgttatactcaacctggatgaggaaaataaaggattgggtaccttgtcctggactgatgatggccagttgctagcactctctacccaaaggggctcacttcatgttttcctgaccaagcttcccatacttggggatgcctgcagcacaaggattgcctatctcacctccctccttgaagtcaccgtagccaaccctgttgaaggagagctaccaatcacagtttctgttgatgtggaacccaactttgtggcagtaggtctttatcatctggctgtaggaatgaataatcgagcttggttttatgtccttggagaaaatgctgtgaaaaaaattgaaagatatggagtatctgggaacagtagccagtatttgccttcattctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: