UROD-uroporphyrinogen decarboxylase Gene View larger

UROD-uroporphyrinogen decarboxylase Gene

PTXBC001778

New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of UROD-uroporphyrinogen decarboxylase Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about UROD-uroporphyrinogen decarboxylase Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC001778
Product type: DNA & cDNA
Ncbi symbol: UROD
Origin species: Human
Product name: UROD-uroporphyrinogen decarboxylase Gene
Size: 2ug
Accessions: BC001778
Gene id: 7389
Gene description: uroporphyrinogen decarboxylase
Synonyms: PCT; UPD; uroporphyrinogen III decarboxylase
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggaagcgaatgggttgggacctcagggttttccggagctgaagaatgacacattcctgcgagcagcctggggagaggaaacagactacactcccgtttggtgcatgcgccaggcaggccgttacttaccagagtttagggaaacccgggctgcccaggactttttcagcacgtgtcgctctcctgaggcctgctgtgaactgactctgcagccactgcgtcgcttccctctggatgctgccatcattttctccgacatccttgttgtaccccaggcactgggcatggaggtgaccatggtacctggcaaaggacccagcttcccagagccattaagagaagagcaggacctagaacgcctacgggatccagaagtggtagcctctgagctaggctatgtgttccaagccatcacccttacccgacaacgactggctggacgtgtgccgctgattggctttgctggtgccccatggaccctgatgacatacatggttgagggtggtggctcaagcaccatggctcaggccaagcgctggctctatcagagacctcaggctagtcaccagctgcttcgcatcctcactgatgctctggtcccatatctggtaggacaagtggtggctggtgcccaggcattgcagctgtttgagtcccatgcagggcatcttggcccacagctcttcaacaagtttgcactgccttacatccgtgatgtggccaagcaagtgaaggccaggttgcgggaggcaggcctggcaccagtgcccatgatcatctttgctaaggatgggcattttgccctggaggagctggcccaagctggctatgaggtggttgggcttgactggacagtggccccaaagaaagcccgggagtgtgtggggaagacggtgacattgcaggtcaacctggacccctgtgccttgtatgcatctgaggaggagatcgggcagttggtgaagcagatgctggatgactttggaccacatcgctacattgccaacctgggccatgggctttatcctgacatggacccagaacatgtgggcgcctttgtggatgctgtgcataaacactcacgtctgcttcgacagaactga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - melanoma antigen family C, 2
- chitinase domain containing 1
- argininosuccinate synthetase 1
- aminoadipate aminotransferase

Buy UROD-uroporphyrinogen decarboxylase Gene now

Add to cart