Login to display prices
Login to display prices
AADAT-aminoadipate aminotransferase Gene View larger

AADAT-aminoadipate aminotransferase Gene

PTXBC031068

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of AADAT-aminoadipate aminotransferase Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about AADAT-aminoadipate aminotransferase Gene

Proteogenix catalog: PTXBC031068
Ncbi symbol: AADAT
Product name: AADAT-aminoadipate aminotransferase Gene
Size: 2ug
Accessions: BC031068
Gene id: 51166
Gene description: aminoadipate aminotransferase
Synonyms: KAT/AadAT; KAT2; KATII; KYAT2; kynurenine/alpha-aminoadipate aminotransferase, mitochondrial; 2-aminoadipate aminotransferase; 2-aminoadipate transaminase; L kynurenine/alpha aminoadipate aminotransferase; alpha-aminoadipate aminotransferase; kynurenine aminotransferase II; kynurenine--oxoglutarate aminotransferase II; kynurenine--oxoglutarate transaminase 2; kynurenine--oxoglutarate transaminase II
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaattacgcacggttcatcacggcagcgagcgcagccagaaacccttctcccatccggaccatgagtgagaaacgggctgacatattgagcagaggaccaaaatcgatgatctccttggctggtggcttaccaaatccaaacatgtttccttttaagactgccgtaatcactgtagaaaatggaaagaccatccaatttggagaagagatgatgaagagagcacttcagtattctccgagtgctggaattccagagcttttgtcctggctaaaacagttacaaataaaattgcataatcctcctaccatccattaccaacccagtcaaggacaaatggatctatgtgtcacatctggcagccaacaaggtctttgtaaggtgtttgaaatgatcattaatcctggagataatgtcctcctagatgaacctgcttattcaggaactcttcaaagtctgcacccactgggctgcaacattattaatgttgccagtgatgaaagtgggattgttccagattccctaagagacatactttccagatggaaaccagaagatgcaaagaatccccagaaaaacacccccaaatttctttatactgttccaaatggcaacaaccctactggaaactcattaaccagtgaacgcaaaaaggaaatctatgagcttgcaagaaaatatgatttcctcataatagaagatgatccttactattttctccagtttaacaagttcagggtaccaacatttctttccatggatgttgatggacgtgtcatcagagctgactctttttcaaaaatcatttcctctgggttgagaataggatttttaactggtccaaaacccttaatagagagagttattttacacatacaagtttcaacattgcaccccagcacttttaaccagctcatgatatcacagcttctacacgaatggggagaagaaggtttcatggctcatgtagacagggttattgatttctatagtaaccagaaggatgcaatactggcagctgcagacaagtggttaactggtttggcagaatggcatgttcctgctgctggaatgtttttatggattaaagttaaaggcattaatgatgtaaaagaactgattgaagaaaaggccgttaagatgggggtattaatgctccctggaaatgctttctacgtcgatagctcagctcctagcccttacttgagagcatccttctcttcagcttctccagaacagatggatgtggccttccaggtattagcacaacttataaaagaatctttatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: