Login to display prices
Login to display prices
MAGEC2-melanoma antigen family C, 2 Gene View larger

MAGEC2-melanoma antigen family C, 2 Gene

PTXBC013318

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of MAGEC2-melanoma antigen family C, 2 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about MAGEC2-melanoma antigen family C, 2 Gene

Proteogenix catalog: PTXBC013318
Ncbi symbol: MAGEC2
Product name: MAGEC2-melanoma antigen family C, 2 Gene
Size: 2ug
Accessions: BC013318
Gene id: 51438
Gene description: melanoma antigen family C, 2
Synonyms: CT10; HCA587; MAGEE1; melanoma-associated antigen C2; MAGE-C2 antigen; MAGE-E1 antigen; cancer/testis antigen 10; hepatocellular cancer antigen 587; hepatocellular carcinoma-associated antigen 587; melanoma antigen family C, 2; melanoma antigen family C2; melanoma antigen, family E, 1, cancer/testis specific; MAGE family member C2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcctcccgttccaggcgttccattccgcaacgctgacaacgactccccgacctcagttgagttagaagactgggtagatgcacagcatcccacagatgaggaagaggaggaagcctcctccgcctcttccactttgtacttagtattttccccctcttctttctccacatcctcttctctgattcttggtggtcctgaggaggaggaggtgccctctggtgtgataccaaatcttaccgagagcattcccagtagtcctccacagggtcctccacagggtccttcccagagtcctctgagctcctgctgctcctctttttcatggagctcattcagtgaggagtccagcagccagaaaggggaggatacaggcacctgtcagggcctgccagacagtgagtcctctttcacatatacactagatgaaaaggtggccgagttagtggagttcctgctcctcaaatacgaagcagaggagcctgtaacagaggcagagatgctgatgattgtcatcaagtacaaagattactttcctgtgatactcaagagagcccgtgagttcatggagcttctttttggccttgccctgatagaagtgggccctgaccacttctgtgtgtttgcaaacacagtaggcctcaccgatgagggtagtgatgatgagggcatgcccgagaacagcctcctgattattattctgagtgtgatcttcataaagggcaactgtgcctctgaggaggtcatctgggaagtgctgaatgcagtaggggtatatgctgggagggagcacttcgtctatggggagcctagggagctcctcactaaagtttgggtgcagggacattacctggagtatcgggaggtgccccacagttctcctccatattatgaattcctgtggggtccaagagcccattcagaaagcatcaagaagaaagtactagagtttttagccaagctgaacaacactgttcctagttcctttccatcctggtacaaggatgctttgaaagatgtggaagagagagtccaggccacaattgataccgcagatgatgccactgtcatggccagtgaaagcctcagtgtcatgtccagcaacgtctccttttctgagtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: