Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of IL8RA-interleukin 8 receptor, alpha Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about IL8RA-interleukin 8 receptor, alpha Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC028221 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | IL8RA |
| Origin species: | Human |
| Product name: | IL8RA-interleukin 8 receptor, alpha Gene |
| Size: | 2ug |
| Accessions: | BC028221 |
| Gene id: | 3577 |
| Gene description: | interleukin 8 receptor, alpha |
| Synonyms: | IL8RA; C-C-CKR-1; CD128; CD181; CDw128a; CKR-1; CMKAR1; IL8R1; IL8RBA; C-X-C chemokine receptor type 1; CXC-R1; CXCR-1; IL-8 receptor type 1; IL-8R A; chemokine (C-X-C motif) receptor 1; high affinity interleukin-8 receptor A; interleukin 8 receptor, alpha; interleukin-8 receptor type 1; interleukin-8 receptor type A; C-X-C motif chemokine receptor 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtcaaatattacagatccacagatgtgggattttgatgatctaaatttcactggcatgccacctgcagatgaagattacagcccctgtaggctagaaactgagacactcaacaagtatgttgtgatcatcgcctatgccctagtgttcctgctgagcctgctgggaaactccctggtgatgctggtcatcttatacagcagggtcggccgctccgtcactgatgtctacctgctgaacctggccttggccgacctactctttgccctgaccttgcccatctgggccgcctccaaggtgaatggctggatttttggcacattcctgtgcaaggtggtctcactcctgaaggaagtcaacttctacagtggcatcctgctgttggcctgcatcagtgtggaccgttacctggccattgtccatgccacacgcacactgacccagaagcgtcacttggtcaagtttgtttgtcttggctgctggggactgtctatgaatctgtccctgcccttcttccttttccgccaggcttaccatccaaacaattccagtccagtttgctatgaggtcctgggaaatgacacagcaaaatggcggatggtgttgcggatcctgcctcacacctttggcttcatcgtgccgctgtttgtcatgctgttctgctatggattcaccctgcgtacactgtttaaggcccacatggggcagaagcaccgagccatgagggtcatctttgctgtcgtcctcatcttcctgctttgctggctgccctacaacctggtcctgctggcagacaccctcatgaggacccaggtgatccaggagagctgtgagcgccgcaacaacatcggccgggccctggatgccactgagattctgggatttctccatagctgcctcaaccccatcatctacgccttcatcggccaaaattttcgccatggattcctcaagatcctggctatgcatggcctggtcagcaaggagttcttggcacgtcattgtgttacctcctacacttcttcgtctgtcaatgtctcttccaacctctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - RAD51 associated protein 1 - uroporphyrinogen decarboxylase - melanoma antigen family C, 2 - chitinase domain containing 1 |