Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
DEF6-differentially expressed in FDCP 6 homolog (mouse) Gene
PTXBC017504
New product
Data sheet of DEF6-differentially expressed in FDCP 6 homolog (mouse) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about DEF6-differentially expressed in FDCP 6 homolog (mouse) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC017504 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | DEF6 |
| Origin species: | Human |
| Product name: | DEF6-differentially expressed in FDCP 6 homolog (mouse) Gene |
| Size: | 2ug |
| Accessions: | BC017504 |
| Gene id: | 50619 |
| Gene description: | differentially expressed in FDCP 6 homolog (mouse) |
| Synonyms: | DEF6, guanine nucleotide exchange factor; SLAT; SWAP70L; differentially expressed in FDCP 6 homolog; DEF-6; IRF4-binding protein; SWAP-70-like adaptor protein of T cells |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggccctgcgcaaggaactgctcaagtccatctggtacgcctttaccgcgctggacgtggagaagagtggcaaagtctccaagtcccagctcaaggtgctgtcccacaacctgtacacggtcctgcacatcccccatgaccccgtggccctggaggaacacttccgagatgatgatgacggccctgtgtccagccagggatacatgccctacctcaacaagtacatcctggacaaggtggaggagggggcttttgttaaagagcactttgatgagctgtgctggacgctgacggccaagaagaactatcgggcagatagcaacgggaacagtatgctctccaatcaggatgccttccgcctctggtgcctcttcaacttcctgtctgaggacaagtaccctctgatcatggttcctgatgaggtggaatacctgctgaaaaaggtactcagcagcatgagcttggaggtgagcttgggtgagctggaggagcttctggcccaggaggcccaggtggcccagaccaccggggggctcagcgtctggcagttcctggagctcttcaattcgggccgctgcctgcggggcgtgggccgggacaccctcagcatggccatccacgaggtctaccaggagctcatccaagatgtcctgaagcagggctacctgtggaagcgagggcacctgagaaggaactgggccgaacgctggttccagctgcagcccagctgcctctgctactttgggagtgaagagtgcaaagagaaaaggggcattatcccgctggatgcacactgctgcgtggaggtgctgccagaccgcgacggaaagcgctgcatgttctgtgtgaagacagccacccgcacgtatgagatgagcgcctcagacacgcgccagcgccaggagtggacagctgccatccagatggcgatccggctgcaggccgaggggaagacgtccctacacaaggacctgaagcagaaacggcgcgagcagcgggagcagcggtag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - carbohydrate (chondroitin 4) sulfotransferase 11 - protein tyrosine phosphatase, non-receptor type 2 - non imprinted in Prader-Willi/Angelman syndrome 2 - ELK3, ETS-domain protein (SRF accessory protein 2) |