DEF6-differentially expressed in FDCP 6 homolog (mouse) Gene View larger

DEF6-differentially expressed in FDCP 6 homolog (mouse) Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of DEF6-differentially expressed in FDCP 6 homolog (mouse) Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about DEF6-differentially expressed in FDCP 6 homolog (mouse) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC017504
Product type: DNA & cDNA
Ncbi symbol: DEF6
Origin species: Human
Product name: DEF6-differentially expressed in FDCP 6 homolog (mouse) Gene
Size: 2ug
Accessions: BC017504
Gene id: 50619
Gene description: differentially expressed in FDCP 6 homolog (mouse)
Synonyms: DEF6, guanine nucleotide exchange factor; SLAT; SWAP70L; differentially expressed in FDCP 6 homolog; DEF-6; IRF4-binding protein; SWAP-70-like adaptor protein of T cells
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggccctgcgcaaggaactgctcaagtccatctggtacgcctttaccgcgctggacgtggagaagagtggcaaagtctccaagtcccagctcaaggtgctgtcccacaacctgtacacggtcctgcacatcccccatgaccccgtggccctggaggaacacttccgagatgatgatgacggccctgtgtccagccagggatacatgccctacctcaacaagtacatcctggacaaggtggaggagggggcttttgttaaagagcactttgatgagctgtgctggacgctgacggccaagaagaactatcgggcagatagcaacgggaacagtatgctctccaatcaggatgccttccgcctctggtgcctcttcaacttcctgtctgaggacaagtaccctctgatcatggttcctgatgaggtggaatacctgctgaaaaaggtactcagcagcatgagcttggaggtgagcttgggtgagctggaggagcttctggcccaggaggcccaggtggcccagaccaccggggggctcagcgtctggcagttcctggagctcttcaattcgggccgctgcctgcggggcgtgggccgggacaccctcagcatggccatccacgaggtctaccaggagctcatccaagatgtcctgaagcagggctacctgtggaagcgagggcacctgagaaggaactgggccgaacgctggttccagctgcagcccagctgcctctgctactttgggagtgaagagtgcaaagagaaaaggggcattatcccgctggatgcacactgctgcgtggaggtgctgccagaccgcgacggaaagcgctgcatgttctgtgtgaagacagccacccgcacgtatgagatgagcgcctcagacacgcgccagcgccaggagtggacagctgccatccagatggcgatccggctgcaggccgaggggaagacgtccctacacaaggacctgaagcagaaacggcgcgagcagcgggagcagcggtag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - carbohydrate (chondroitin 4) sulfotransferase 11
- protein tyrosine phosphatase, non-receptor type 2
- non imprinted in Prader-Willi/Angelman syndrome 2
- ELK3, ETS-domain protein (SRF accessory protein 2)

Buy DEF6-differentially expressed in FDCP 6 homolog (mouse) Gene now

Add to cart