Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of FGF1-fibroblast growth factor 1 (acidic) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about FGF1-fibroblast growth factor 1 (acidic) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC032697 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | FGF1 |
| Origin species: | Human |
| Product name: | FGF1-fibroblast growth factor 1 (acidic) Gene |
| Size: | 2ug |
| Accessions: | BC032697 |
| Gene id: | 2246 |
| Gene description: | fibroblast growth factor 1 (acidic) |
| Synonyms: | AFGF; ECGF; ECGF-beta; ECGFA; ECGFB; FGF-1; FGF-alpha; FGFA; GLIO703; HBGF-1; HBGF1; fibroblast growth factor 1; beta-endothelial cell growth factor; endothelial cell growth factor, alpha; endothelial cell growth factor, beta; fibroblast growth factor 1 (acidic); heparin-binding growth factor 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggctgaaggggaaatcaccaccttcacagccctgaccgagaagtttaatctgcctccagggaattacaagaagcccaaactcctctactgtagcaacgggggccacttcctgaggatccttccggatggcacagtggatgggacaagggacaggagcgaccagcacattcagctgcagctcagtgcggaaagcgtgggggaggtgtatataaagagtaccgagactggccagtacttggccatggacaccgacgggcttttatacggctcacagacaccaaatgaggaatgtttgttcctggaaaggctggaggagaaccattacaacacctatatatccaagaagcatgcagagaagaattggtttgttggcctcaagaagaatgggagctgcaaacgcggtcctcggactcactatggccagaaagcaatcttgtttctccccctgccagtctcttctgattaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - leucine rich repeat containing 39 - cysteinyl leukotriene receptor 1 - leucine-rich alpha-2-glycoprotein 1 - thioredoxin domain containing 13 |