Login to display prices
Login to display prices
FGF1-fibroblast growth factor 1 (acidic) Gene View larger

FGF1-fibroblast growth factor 1 (acidic) Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of FGF1-fibroblast growth factor 1 (acidic) Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about FGF1-fibroblast growth factor 1 (acidic) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC032697
Product type: DNA & cDNA
Ncbi symbol: FGF1
Origin species: Human
Product name: FGF1-fibroblast growth factor 1 (acidic) Gene
Size: 2ug
Accessions: BC032697
Gene id: 2246
Gene description: fibroblast growth factor 1 (acidic)
Synonyms: AFGF; ECGF; ECGF-beta; ECGFA; ECGFB; FGF-1; FGF-alpha; FGFA; GLIO703; HBGF-1; HBGF1; fibroblast growth factor 1; beta-endothelial cell growth factor; endothelial cell growth factor, alpha; endothelial cell growth factor, beta; fibroblast growth factor 1 (acidic); heparin-binding growth factor 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggctgaaggggaaatcaccaccttcacagccctgaccgagaagtttaatctgcctccagggaattacaagaagcccaaactcctctactgtagcaacgggggccacttcctgaggatccttccggatggcacagtggatgggacaagggacaggagcgaccagcacattcagctgcagctcagtgcggaaagcgtgggggaggtgtatataaagagtaccgagactggccagtacttggccatggacaccgacgggcttttatacggctcacagacaccaaatgaggaatgtttgttcctggaaaggctggaggagaaccattacaacacctatatatccaagaagcatgcagagaagaattggtttgttggcctcaagaagaatgggagctgcaaacgcggtcctcggactcactatggccagaaagcaatcttgtttctccccctgccagtctcttctgattaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - leucine rich repeat containing 39
- cysteinyl leukotriene receptor 1
- leucine-rich alpha-2-glycoprotein 1
- thioredoxin domain containing 13