CYSLTR1-cysteinyl leukotriene receptor 1 Gene View larger

CYSLTR1-cysteinyl leukotriene receptor 1 Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CYSLTR1-cysteinyl leukotriene receptor 1 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about CYSLTR1-cysteinyl leukotriene receptor 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC035750
Product type: DNA & cDNA
Ncbi symbol: CYSLTR1
Origin species: Human
Product name: CYSLTR1-cysteinyl leukotriene receptor 1 Gene
Size: 2ug
Accessions: BC035750
Gene id: 10800
Gene description: cysteinyl leukotriene receptor 1
Synonyms: CYSLT1; CYSLT1R; CYSLTR; HMTMF81; cysteinyl leukotriene receptor 1; G-protein coupled receptor HG55; LTD4 receptor; cysteinyl leukotriene D4 receptor
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggatgaaacaggaaatctgacagtatcttctgccacatgccatgacactattgatgacttccgcaatcaagtgtattccaccttgtactctatgatctctgttgtaggcttctttggcaatggctttgtgctctatgtcctcataaaaacctatcacaagaagtcagccttccaagtatacatgattaatttagcagtagcagatctactttgtgtgtgcacactgcctctccgtgtggtctattatgttcacaaaggcatttggctctttggtgacttcttgtgccgcctcagcacctatgctttgtatgtcaacctctattgtagcatcttctttatgacagccatgagctttttccggtgcattgcaattgtttttccagtccagaacattaatttggttacacagaaaaaagccaggtttgtgtgtgtaggtatttggatttttgtgattttgaccagttctccatttctaatggccaaaccacaaaaagatgagaaaaataataccaagtgctttgagcccccacaagacaatcaaactaaaaatcatgttttggtcttgcattatgtgtcattgtttgttggctttatcatcccttttgttattataattgtctgttacacaatgatcattttgaccttactaaaaaaatcaatgaaaaaaaatctgtcaagtcataaaaaggctataggaatgatcatggtcgtgaccgctgcctttttagtcagtttcatgccatatcatattcaacgtaccattcaccttcattttttacacaatgaaactaaaccctgtgattctgtccttacaatgcagaagtccgtggtcataaccttgtctctggctgcatccaattgttgctttgaccctctcctatatttcttttctgggggtaactttaggaaaaggctgtctacatttagaaagcattctttgtccagcgtgacttatgtacccagaaagaaggcctctttgccagaaaaaggagaagaaatatgtaaagtatag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - leucine-rich alpha-2-glycoprotein 1
- thioredoxin domain containing 13
- mitochondrial E3 ubiquitin ligase 1
- chemokine (C-X-C motif) receptor 7

Buy CYSLTR1-cysteinyl leukotriene receptor 1 Gene now

Add to cart