LRRC39-leucine rich repeat containing 39 Gene View larger

LRRC39-leucine rich repeat containing 39 Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of LRRC39-leucine rich repeat containing 39 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about LRRC39-leucine rich repeat containing 39 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC009613
Product type: DNA & cDNA
Ncbi symbol: LRRC39
Origin species: Human
Product name: LRRC39-leucine rich repeat containing 39 Gene
Size: 2ug
Accessions: BC009613
Gene id: 127495
Gene description: leucine rich repeat containing 39
Synonyms: leucine-rich repeat-containing protein 39; densin hlg; leucine rich repeat containing 39
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgacagaaaatgtggtttgtactggggctgtcaatgctgtaaaggaagtttgggaaaaaagaataaagaaactcaatgaagacctgaagcgagagaaggaatttcaacacaagctagtgcggatctgggaagaacgagtaagcttaaccaagctaagagaaaaggtcaccagggaagatggaagagtcattttgaagatagaaaaagaggaatggaagaccctcccttcttctctgctgaaactgaatcaactacaggaatggcaacttcatagaactggtttgctgaaaattcctgaattcattggaagattccagaacctcattgtgttagatttatctcgaaacacaatttcagagataccaccagggattggactgcttactagacttcaggaactgattctcagctacaacaaaatcaagactgtccccaaggaactaagtaattgtgccagcttggagaaactagaactggctgttaacagagatatatgtgatcttccacaagagctcagcaatctgctaaaacttactcaccttgatctgagtatgaacgattttactacaatccctcttgctgtgttgaacatgcctgcccttgagtggctggacatgggaagcaacaaacttgaacaacttcctgatactatagaaagaatgcaaaatctacatacgttatggctgcaacgaaatgaaataacatgcttgcctcaaacaatcagcaatatgaaaaatctgggtactcttgttctcagcaacaataaactgcaagatattccagtatgcatggaagaaatggcaaatctgaggtttgtcaacttcagagacaacccactgaaattgaaagtatcacttcctcccagtgaaggcacagatgaagaagaggaacgggaattatttggccttcagtttatgcacacatacatacaagagtcacggagaagagcagatcaccaagtcaacggttcaactactttaccaatctccataaatacggatggataa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - cysteinyl leukotriene receptor 1
- leucine-rich alpha-2-glycoprotein 1
- thioredoxin domain containing 13
- mitochondrial E3 ubiquitin ligase 1

Buy LRRC39-leucine rich repeat containing 39 Gene now

Add to cart