PPY-pancreatic polypeptide Gene View larger

PPY-pancreatic polypeptide Gene

PTXBC032225

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PPY-pancreatic polypeptide Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about PPY-pancreatic polypeptide Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC032225
Product type: DNA & cDNA
Ncbi symbol: PPY
Origin species: Human
Product name: PPY-pancreatic polypeptide Gene
Size: 2ug
Accessions: BC032225
Gene id: 5539
Gene description: pancreatic polypeptide
Synonyms: PNP; pancreatic prohormone; pancreatic polypeptide Y; prepro-PP (prepropancreatic polypeptide)
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggctgccgcacgcctctgcctctccctgctgctcctgtccacctgcgtggctctgttactacagccactgctgggtgcccagggagccccactggagccagtgtacccaggggacaatgccacaccagagcagatggcccagtatgcagctgatctccgtagatacatcaacatgctgaccaggcctaggtatgggaaaagacacaaagaggacacgctggccttctcggagtgggggtccccgcatgctgctgtccccagggagctcagcccgctggacttataa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - apolipoprotein C-III
- ring finger protein 2
- IQ motif containing D
- creatine kinase, brain

Buy PPY-pancreatic polypeptide Gene now

Add to cart