RNF2-ring finger protein 2 Gene View larger

RNF2-ring finger protein 2 Gene

PTXBC012583

New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of RNF2-ring finger protein 2 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about RNF2-ring finger protein 2 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC012583
Product type: DNA & cDNA
Ncbi symbol: RNF2
Origin species: Human
Product name: RNF2-ring finger protein 2 Gene
Size: 2ug
Accessions: BC012583
Gene id: 6045
Gene description: ring finger protein 2
Synonyms: BAP-1; BAP1; DING; HIPI3; RING1B; RING2; E3 ubiquitin-protein ligase RING2; HIP2-interacting protein 3; RING finger protein 1B; RING finger protein BAP-1; huntingtin-interacting protein 2-interacting protein 3; protein DinG; ring finger protein 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtctcaggctgtgcagacaaacggaactcaaccattaagcaaaacatgggaactcagtttatatgagttacaacgaacacctcaggaggcaataacagatggcttagaaattgtggtttcacctcgaagtctacacagtgaattaatgtgcccaatttgtttggatatgttgaagaacaccatgactacaaaggagtgtttacatcgtttttgtgcagactgcatcatcacagcccttagaagtggcaacaaagaatgtcctacctgtcggaaaaaactagtttccaaaagatcactaaggccagacccaaactttgatgcactcatcagcaaaatttatccaagtcgtgatgagtatgaagctcatcaagagagagtattagccaggatcaacaagcacaataatcagcaagcactcagtcacagcattgaggaaggactgaagatacaggccatgaacagactgcagcgaggcaagaaacaacagattgaaaatggtagtggagcagaagataatggtgacagttcacactgcagtaatgcatccacacatagcaatcaggaagcaggccctagtaacaaacggaccaaaacatctgatgattctgggctagagcttgataataacaatgcagcaatggcaattgatccagtaatggatggtgctagtgaaattgaattagtattcaggcctcatcccacacttatggaaaaagatgacagtgcacagacgagatacataaagacttctggtaacgccactgttgatcacttatccaagtatctggctgtgaggttagctttagaagaacttcgaagcaaaggtgaatcaaaccagatgaaccttgatacagccagtgagaagcagtataccatttatatagcaacagccagtggccagttcactgtattaaatggctctttttctttggaattggtcagtgagaaatactggaaagtgaacaaacccatggaactttattacgcacctacaaaggagcacaaatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - IQ motif containing D
- creatine kinase, brain
- reticulon 4 receptor
- seryl-tRNA synthetase

Buy RNF2-ring finger protein 2 Gene now

Add to cart