APOC3-apolipoprotein C-III Gene View larger

APOC3-apolipoprotein C-III Gene

PTXBC027977

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of APOC3-apolipoprotein C-III Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about APOC3-apolipoprotein C-III Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC027977
Product type: DNA & cDNA
Ncbi symbol: APOC3
Origin species: Human
Product name: APOC3-apolipoprotein C-III Gene
Size: 2ug
Accessions: BC027977
Gene id: 345
Gene description: apolipoprotein C-III
Synonyms: APOCIII; HALP2; apolipoprotein C-III; apo-CIII; apoC-III; apolipoprotein C3
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcagccccgggtactccttgttgttgccctcctggcgctcctggcctctgcccgagcttcagaggccgaggatgcctcccttctcagcttcatgcagggttacatgaagcacgccaccaagaccgccaaggatgcactgagcagcgtgcaggagtcccaggtggcccagcaggccaggggctgggtgaccgatggcttcagttccctgaaagactactggagcaccgttaaggacaagttctctgagttctgggatttggaccctgaggtcagaccaacttcagccgtggctgcctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - ring finger protein 2
- IQ motif containing D
- creatine kinase, brain
- reticulon 4 receptor

Reviews

Buy APOC3-apolipoprotein C-III Gene now

Add to cart