THTPA-thiamine triphosphatase Gene View larger

THTPA-thiamine triphosphatase Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of THTPA-thiamine triphosphatase Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about THTPA-thiamine triphosphatase Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC002984
Product type: DNA & cDNA
Ncbi symbol: THTPA
Origin species: Human
Product name: THTPA-thiamine triphosphatase Gene
Size: 2ug
Accessions: BC002984
Gene id: 79178
Gene description: thiamine triphosphatase
Synonyms: THTP; THTPASE; thiamine-triphosphatase
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcccagggcttgattgaggtggagcgaaagttccttccagggcctggcacagaggagcggctgcaggagttggggggcaccctggagtaccgggtcaccttccgagacacctactatgacacccctgagctgagcctcatgcaggctgaccactggctgcgacgacgagaggatagtggatgggagctcaaatgtcctggagcagcaggtgtcttaggaccccacacggagtataaggaactcacagcggaacctacaattgtggcccaactctgtaaggtgctgcgggctgacggcctgggggctggagatgtggctgctgtgctgggcccactggggctgcaggaagtagctagttttgtgactaagcggagtgcctggaagctggtgctcttgggagctgatgaagaggagccacagctcagggtggacttggatacagccgactttggctacgctgtgggtgaggtagaggccctggtgcatgaggaggctgaagtaccaactgccctagagaagatccacaggctcagcagcatgcttggtgtgcctgcacaggagacagcaccagccaagctgattgtgtatctacagcgtttccggcctcaagactatcagcgcctgctagaagtgaacagctccagagagaggccacaggagactgaagatcctgaccactgcctgggctag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - ADP-ribosyltransferase 5
- neuroligin 4, Y-linked
- frizzled-related protein
- programmed cell death 6

Buy THTPA-thiamine triphosphatase Gene now

Add to cart