Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
PSMB2-proteasome (prosome, macropain) subunit, beta type, 2 Gene
PTXBC000268
New product
Data sheet of PSMB2-proteasome (prosome, macropain) subunit, beta type, 2 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about PSMB2-proteasome (prosome, macropain) subunit, beta type, 2 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC000268 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | PSMB2 |
| Origin species: | Human |
| Product name: | PSMB2-proteasome (prosome, macropain) subunit, beta type, 2 Gene |
| Size: | 2ug |
| Accessions: | BC000268 |
| Gene id: | 5690 |
| Gene description: | proteasome (prosome, macropain) subunit, beta type, 2 |
| Synonyms: | HC7-I; proteasome subunit beta type-2; macropain subunit C7-I; multicatalytic endopeptidase complex subunit C7-1; multicatalytic endopeptidase complex subunit C7-I; proteasome (prosome, macropain) subunit, beta type, 2; proteasome beta 2 subunit; proteasome component C7-I; proteasome subunit, beta type, 2; testicular tissue protein Li 152; proteasome subunit beta 2 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggagtacctcatcggtatccaaggccccgactatgttcttgtcgcctccgaccgggtggccgccagcaatattgtccagatgaaggacgatcatgacaagatgtttaagatgagtgaaaagatattactcctgtgtgttggagaggctggagacactgtacagtttgcagaatatattcagaaaaacgtgcaactttataagatgcgaaatggatatgaattgtctcccacggcagcagctaacttcacacgccgaaacctggctgactgtcttcggagtcggaccccatatcatgtgaacctcctcctggctggctatgatgagcatgaagggccagcgctgtattacatggactacctggcagccttggccaaggccccttttgcagcccacggctatggtgccttcctgactctcagtatcctcgaccgatactacacaccgactatctcacgtgagagggcagtggaactccttaggaaatgtctggaggagctccagaaacgcttcatcctgaatctgccaaccttcagtgttcgaatcattgacaaaaatggcatccatgacctggataacatttccttccccaaacagggctcctaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - eukaryotic translation initiation factor 3, subunit K - proteasome (prosome, macropain) subunit, beta type, 1 - cleavage and polyadenylation specific factor 4, 30kDa - proteasome (prosome, macropain) subunit, beta type, 7 |