PSMB2-proteasome (prosome, macropain) subunit, beta type, 2 Gene View larger

PSMB2-proteasome (prosome, macropain) subunit, beta type, 2 Gene

PTXBC000268

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PSMB2-proteasome (prosome, macropain) subunit, beta type, 2 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about PSMB2-proteasome (prosome, macropain) subunit, beta type, 2 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC000268
Product type: DNA & cDNA
Ncbi symbol: PSMB2
Origin species: Human
Product name: PSMB2-proteasome (prosome, macropain) subunit, beta type, 2 Gene
Size: 2ug
Accessions: BC000268
Gene id: 5690
Gene description: proteasome (prosome, macropain) subunit, beta type, 2
Synonyms: HC7-I; proteasome subunit beta type-2; macropain subunit C7-I; multicatalytic endopeptidase complex subunit C7-1; multicatalytic endopeptidase complex subunit C7-I; proteasome (prosome, macropain) subunit, beta type, 2; proteasome beta 2 subunit; proteasome component C7-I; proteasome subunit, beta type, 2; testicular tissue protein Li 152; proteasome subunit beta 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggagtacctcatcggtatccaaggccccgactatgttcttgtcgcctccgaccgggtggccgccagcaatattgtccagatgaaggacgatcatgacaagatgtttaagatgagtgaaaagatattactcctgtgtgttggagaggctggagacactgtacagtttgcagaatatattcagaaaaacgtgcaactttataagatgcgaaatggatatgaattgtctcccacggcagcagctaacttcacacgccgaaacctggctgactgtcttcggagtcggaccccatatcatgtgaacctcctcctggctggctatgatgagcatgaagggccagcgctgtattacatggactacctggcagccttggccaaggccccttttgcagcccacggctatggtgccttcctgactctcagtatcctcgaccgatactacacaccgactatctcacgtgagagggcagtggaactccttaggaaatgtctggaggagctccagaaacgcttcatcctgaatctgccaaccttcagtgttcgaatcattgacaaaaatggcatccatgacctggataacatttccttccccaaacagggctcctaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - eukaryotic translation initiation factor 3, subunit K
- proteasome (prosome, macropain) subunit, beta type, 1
- cleavage and polyadenylation specific factor 4, 30kDa
- proteasome (prosome, macropain) subunit, beta type, 7

Buy PSMB2-proteasome (prosome, macropain) subunit, beta type, 2 Gene now

Add to cart