Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
PSMB7-proteasome (prosome, macropain) subunit, beta type, 7 Gene
PTXBC000509
New product
Data sheet of PSMB7-proteasome (prosome, macropain) subunit, beta type, 7 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about PSMB7-proteasome (prosome, macropain) subunit, beta type, 7 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC000509 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | PSMB7 |
| Origin species: | Human |
| Product name: | PSMB7-proteasome (prosome, macropain) subunit, beta type, 7 Gene |
| Size: | 2ug |
| Accessions: | BC000509 |
| Gene id: | 5695 |
| Gene description: | proteasome (prosome, macropain) subunit, beta type, 7 |
| Synonyms: | proteasome subunit beta type-7; macropain chain Z; multicatalytic endopeptidase complex chain Z; proteasome (prosome, macropain) subunit, beta type, 7; proteasome catalytic subunit 2; proteasome subunit Z; proteasome subunit alpha; protein serine kinase c17; proteasome subunit beta 7 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcggctgtgtcggtgtatgctccaccagttggaggcttctcttttgataactgccgcaggaatgccgtcttggaagccgattttgcaaagaggggatacaagcttccaaaggcccggaaaactggcacgaccatcgctggggtggtctataaggatggcatagttcttggagcagatacaagagcaactgaagggatggttgttgctgacaagaactgttcaaaaatacacttcatatctcctaatatttattgttgtggtgctgggacagctgcagacacagacatgacaacccagctcatttcttccaacctggagctccactccctctccactggccgtcttcccagagttgtgacagccaatcggatgctgaagcagatgcttttcaggtatcaaggttacattggtgcagccctagttttagggggagtagatgttactggacctcacctctacagcatctatcctcatggatcaactgataagttgccttatgtcaccatgggttctggctccttggcagcaatggctgtatttgaagataagtttaggccagacatggaggaggaggaagccaagaatctggtgagcgaagccatcgcagctggcatcttcaacgacctgggctccggaagcaacattgacctctgcgtcatcagcaagaacaagctggattttctccgcccatacacagtgcccaacaagaaggggaccaggcttggccggtacaggtgtgagaaagggactactgcagtcctcactgagaaaatcactcctctggagattgaggtgctggaagaaacagtccaaacaatggacacttcctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - nucleophosmin (nucleolar phosphoprotein B23, numatrin) - nucleophosmin (nucleolar phosphoprotein B23, numatrin) - TruB pseudouridine (psi) synthase homolog 1 (E. coli) - membrane bound O-acyltransferase domain containing 2 |