Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
MBOAT2-membrane bound O-acyltransferase domain containing 2 Gene
PTXBC016005
New product
Data sheet of MBOAT2-membrane bound O-acyltransferase domain containing 2 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about MBOAT2-membrane bound O-acyltransferase domain containing 2 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC016005 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | MBOAT2 |
| Origin species: | Human |
| Product name: | MBOAT2-membrane bound O-acyltransferase domain containing 2 Gene |
| Size: | 2ug |
| Accessions: | BC016005 |
| Gene id: | 129642 |
| Gene description: | membrane bound O-acyltransferase domain containing 2 |
| Synonyms: | LPAAT; LPCAT4; LPEAT; LPLAT 2; OACT2; lysophospholipid acyltransferase 2; 1-acylglycerophosphate O-acyltransferase; 1-acylglycerophosphoethanolamine O-acyltransferase; O-acyltransferase (membrane bound) domain containing 2; lyso-PA acyltransferase; lyso-PE acyltransferase; lysophosphatidic acid acyltransferase; lysophosphatidylethanolamine acyltransferase; membrane-bound O-acyltransferase domain-containing protein 2; membrane bound O-acyltransferase domain containing 2 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgccaagcttactggagtatttgagttacaactgtaacttcatggggatcctggcaggcccactttgctcttacaaagactacattactttcattgaaggcagatcataccatatcacacaatctggtgaaaatggaaaagaagagacacagtatgaaagaacagagccatctccaaatactgcggttgttcagaagctcttagtttgtgggctgtccttgttatttcacttgaccatctgtacaacattacctgtggagtacaacattgatgagcattttcaagctacagcttcgtggccaacaaagattatctatctgtatatctctcttttggctgccagacccaaatactattttgcatggacgctagctgatgccattaataatgctgcaggctttggtttcagagggtatgacgaaaatggagcagctcgctgggacttaatttccaatttgagaattcaacaaatagagatgtcaacaagtttcaagatgtttcttgataattggaatattcagacagctctttggctcaaaagggtgtgttatgaacgaacctccttcagtccaactatccagacgttcattctctctgccatttggcacggggtatacccaggatattatctaacgtttctaacaggggtgttaatgacattagcagcaagagctatgagaaataactttagacattatttcattgaaccttcccaactgaaattattttatgatgttataacatggatagtaactcaagtagcaataagttacacagttgtgccatttgtgcttctttctataaaaccatcactcacgttttacagctcctggtattattgcctgcacattcttggtatcttagtattattgttgttgccagtgaaaaaaactcaaagaagaaagaatacacatgaaaacattcagctctcacaatccaaaaagtttgatgaaggagaaaattctttgggacagaacagtttttctacaacaaacaatgtttgcaatcagaatcaagaaatagcctcgagacattcatcactaaagcagtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - eukaryotic translation initiation factor 3, subunit H - interferon stimulated exonuclease gene 20kDa-like 2 - dopamine beta-hydroxylase (dopamine beta-monooxygenase) - protein phosphatase, EF-hand calcium binding domain 1 |